Basic Information

Symbol
TPSAB1
RNA class
mRNA
Alias
Tryptase Alpha/Beta 1 TPSB1 TPS1 TPS2 Tryptase Alpha/Beta-1 Mast Cell Tryptase Tryptase Alpha II Tryptase Alpha-1 Tryptase Beta I Tryptase-III EC 3.4.21.59 Tryptase-I Tryptase-1 Epididymis Secretory Sperm Binding Protein Mast Cell Alpha II Tryptase Mast Cell Beta I Tryptase Tryptase Beta 1 Tryptase Beta-2 Tryptase Beta-1 Tryptase-II Tryptase II Tryptase-2 Tryptase I EC 3.4.21 TPSB2
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Wound age identification

MANE select

Transcript ID
NM_003294.4
Sequence length
1166.0 nt
GC content
0.6475

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-484.10 kcal/mol
Thermodynamic ensemble
Free energy: -504.29 kcal/mol
Frequency: 0.0000
Diversity: 284.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((.(((((((.((((((((((..(((.((((((((((.(((.(((.((.....((((.((((((....))))))...))))...)).))))))..))))).)))))((.((.(.(((((((....)))))))).)))).((((((..(((.(((((..(.(.(..((((((((((((...)))..))..(((((((((((............)))))(((((((((((.((((((.(((((..(.(((.((((((......).)))))...))).)..)))))..))))))...))))))))..))).....((((.((....)).)))).))))))((((((.((.((..((((((((((((((((.....)).)))).........)).))))))))..)).)))))))).((((.(((((((.(((((((((((..(((((.........................)))))..)))))).)))).)..))))))))))).)))))))..).).)..))))).)))..))))))(((((....(((((.(((((...(((...))).....(((....))).(((.((........)).)))..(((((((.(.....((((((.......)).))))...).)))))))(((((....)))))((((...((((((((((.(.(((....))))))))))))))..(((((.....)))))(((((((((.(((.(((.((((.(((((((((((.((((..(((((((...((((((((...(((....)))((((.........(((((((........))).))))..........)))))))))))))))))))(((((((((((....(((((.........((.(((.....))).))...))))).)))))))))))..........)))))))))...))))))..)))).))))))..)))))....))))))))((((......)))).))))).)))))...)))))...)))..))))))).)))...))))))))))).....(((.(((.((((((((.......((((.((((.((.......)).)).)).)))).........)))).)))).)).).)))...................
Thermodynamic Ensemble Prediction
....(((,,(((((((.((((((((((..(({.,{,(((((((((((((.((..(((((((.{.((((((....)))))).{{((((,{.||{,|}{{{{.||.,,..}})))}.,,.,.((((((,,{{,(|({{(({({{({{{((((({.(((((((,,..|}|}...,.})).}))||,..}}}}.,|}|}}}})}}|||||}}.}.......})))))(({((((((((.((((((.(((((..{.(((.((((((......).)))))...))).}..)))))..))))))...)))))))},.}}}.)))))))..)).)).))))),)))))),,((((((.((.((..((((((((((((((((.....)).)))).........)).))))))))..)).)))))))).{{{{,(((((((.(((((((((({,,(((((....,,{...|,,.}..........))))).,)))))).)))).,..))))))))}||.,||||,,...{{{{.{{{..,.,,,.))))}}}(((((.,..(((((.(((((,,,{(({{{{||.....|||,,}}))).(((.,,........}},)))..{{((((({{,.,,.,{|||{{,|||||,}.)}}),,.),)}))))}(((((....))))){(((...((((((((((.(.(((....))))))))))))))..(((((.....)))))(((((((((.(((.(((.((((.(((((((((((.((((..(((((((...((((((((...,{(....}}}((((...,.....(((((((........,},.))))......,,..)))))))))))))))))))(((((((((((....(((((,,.......|{.,||,,...,,,.,,..,}}))).)))))))))))..........}}))}},,)..,))))))..)))).)))})),.)))))....))))}}}}((((......)))).))))).)))))...)))))...}))..))))))).)))...)))))))))))..,,,(((.(((.((((((((......,(({(.((((.((,,,,...}),)).)).)))},........)))).)))).)).).))}.....}.}}..,.......

Transcripts

ID Sequence Length GC content
UAGAAGGAACAGGGAGCGGCCAGGAUGCUGAAUCUGCUGCUGCUGGCGC… 1166 nt 0.6475
Summary

Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. These genes are characterized by several distinct features. They have a highly conserved 3' UTR and contain tandem repeat sequences at the 5' flank and 3' UTR which are thought to play a role in regulation of the mRNA stability. These genes have an intron immediately upstream of the initiator Met codon, which separates the site of transcription initiation from protein coding sequence. This feature is characteristic of tryptases but is unusual in other genes. The alleles of this gene exhibit an unusual amount of sequence variation, such that the alleles were once thought to represent two separate genes, alpha and beta 1. Beta tryptases appear to be the main isoenzymes expressed in mast cells; whereas in basophils, alpha tryptases predominate. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human skin wound healing identified the TPSAB1 as a marker for mast cell identification, where it was expressed in mast cell clusters [Liu et al. DOI:10.1016/j.stem.2024.11.013]. In a separate study of human corpus cavernosum from patients with erectile dysfunction, the TPSAB1 was also identified as a mast cell marker expressed in mast cells [Fang et al. DOI:10.3389/fendo.2022.874915].