Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUCCGGGCGCGCUGCGACCGUUGGGGCUUUGUUCGCGGGGGUCACAG… | 2266 nt | 0.6130 |
Summary
The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from members of the TNF receptor superfamily. This protein directly interacts with TNF receptors, and forms a heterodimeric complex with TRAF1. This protein is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF1 interacts with the inhibitor-of-apoptosis proteins (IAPs), and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of IAPs for the direct inhibition of caspase activation. BIRC2/c-IAP1, an apoptosis inhibitor possessing ubiquitin ligase activity, can unbiquitinate and induce the degradation of this protein, and thus potentiate TNF-induced apoptosis. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been determined. [provided by RefSeq, Jul 2008]
Forensic Context
A study in human prostate tissues demonstrated that the TRAF2 was significantly upregulated at longer postmortem intervals (96 h and 120 h) compared to a 24 h control, as part of a broader finding that pro-apoptotic gene expression becomes dominant over time [Tolbert et al. DOI:10.1016/j.gene.2018.06.090]. A systematic review of human and animal model studies found that in bone marrow, the TRAF2 shows positive immunostaining in osteoclasts for post-mortem intervals of less than seven days and is usually negative for intervals greater than seven days, providing additional information for PMI estimation [Salerno et al. DOI:10.3390/diagnostics12092114].