| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAACAUCUGCUACUACAGCCUUGCAGCCCGGAGUCCCGGAUUUUACUGG… | 971 nt | 0.6416 | |
| AUGGAAUCCACUAAGAAGGGGCGAGACCAGUGAGGAUUCAACUAAAGGG… | 1913 nt | 0.5855 |
The protein encoded by this gene belongs to the acetyltransferase superfamily. It is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. Melatonin is essential for the function of the circadian clock that influences activity and sleep. This enzyme is regulated by cAMP-dependent phosphorylation that promotes its interaction with 14-3-3 proteins and thus protects the enzyme against proteasomal degradation. This gene may contribute to numerous genetic diseases such as delayed sleep phase syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
A study in humans using RNA-seq and scRNA-seq data from peripheral blood mononuclear cells and whole blood samples identified multiple differentially expressed circadian rhythm-related genes in sepsis patients versus controls, including the AANAT which was analyzed but showed no significant differential expression in subsequent RT-qPCR validation on samples from 10 patients and 10 healthy individuals [Wang et al. DOI:10.3390/ijms26093993].