| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCAGUGGGAGCAGCGGCAGCAGCUUCGGCUGCUGCUUUCAGGCUGCCG… | 6389 nt | 0.4156 |
Predicted to enable GABA receptor binding activity and myosin binding activity. Predicted to be involved in several processes, including mitochondrion distribution; protein O-linked glycosylation; and vesicle transport along microtubule. Predicted to be located in cytoplasm; nucleus; and plasma membrane. Predicted to be active in cytoplasmic vesicle; dendrite; and mitochondrion. [provided by Alliance of Genome Resources, Apr 2025]
A longitudinal mRNA expression analysis in human post-mortem blood samples identified the TRAK2 as a protein-coding gene with an up-regulated expression pattern after death, where it is involved in the establishment of mitochondrion localization [Antiga et al. DOI:10.1038/s41598-021-96095-z].