Basic Information

Symbol
TRARG1
RNA class
mRNA
Alias
Trafficking Regulator Of GLUT4 (SLC2A4) 1 (Gene/Pseudogene) IFITMD3 LOST1 DSPB1 Dispanin Subfamily B Member 1 Tumor Suppressor Candidate 5 BEC-1 TUSC5 Interferon-Induced Transmembrane Domain-Containing Protein D3 Interferon Induced Transmembrane Protein Domain Containing 3 Protein Located At Seventeen-P-Thirteen Point Three 1 Located At Seventeen P Thirteen Point Three 1 Brain Endothelial Cell Derived Gene-1 Trafficking Regulator Of GLUT4 1 Trafficking Regulator Of GLUT4 (SLC2A4) 1
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_172367.3
Sequence length
3588.0 nt
GC content
0.6187

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1531.3 kcal/mol
Thermodynamic ensemble
Free energy: -1586.6 kcal/mol
Frequency: 0.0000
Diversity: 748.29
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((....((((((.(((((.((((((((((..((((((((....((((((((((.((.(((((.((......(((((....((((..(...(((((((.(((((((........(((.((((..(((((((((..(((((((....)))).........((((((((...)))).)))).........((.((.....)).))(((((........)))))..))).)))))))))...((((((.(((((((..(.((((.....)))).))))))))..)))))))))))))........).))))))))))))).)..))))....)))))......))......))))).))..)))........)))))))((..((((.((.....(((((.((..((((((((.((.((((...)))))).))..))))).)..)).)))))....)).))))..)).(((...))).((((.(((((.(((((.(((((.(((........((((....))))....((((......((((((.(((..(((((......)))))))).))))))...))))......(((((((((........))).....)))))).))))).))))).))).))))).))))......((((((((((.((..((((.(((((.......(.(((((.(((...((((...............(((((..(((((.(..(((...)))..).)))))..))))).(((.(((((.((((((((((...(.(((.((((((((((....(((((....((((((.((((((.......)))))).)))))).......((((........))))............).)))).))))))).))).))).))))))).)))).)))))...)))....(((((.....))))).((.(((((((((........))))..))))).))....((((((...((...((((....(((......)))))))......((((((.......)))))).....)).)))))))))).)))...)).))))(((((((..(((....((((...((....((((((.....(((((........)))))..))))))...)).........))))....))))))))))....)))))))))..)).)))))))))).(((((((((.((...(((((((...((((.((((....(((((((((.((.((......)))))))))))))))))..))))..........)))))))..........)).))))))))).))))))))..)))))).(((..(((((...))))).))).((((..(((.......))).))))...)))).)))))))))))((((((...))))))(((.(((.....))).)))(((((..((((((((((((.....(((((((((((((....))))).)))........((((((..(((((((((((((((((.((.(((((....))))).)).((.((((((((((..((((..(((((((..................(((.(((((.((.(.((((....)))))))))))).)))((((((.((((((...(((((.(((((((....((((((..((((.((.(((....))))).))))))).)))..)))))))..)))))))).)))...))))))...(((((.(((.(.((((.((((((((..((((((((((((((((((.(((((....))))).)))).((((((((((((((((.((((((((((((.((...(((((((.((((.((..(.....)..))))))((((((((..((((((..((((....(((((((((...........((((.((.(((((.((((((((....)))).))))...((((.((((((((.(((...(((((((((((........))))..((((.((.(((((((((((....(((((.((.(((((.((...((....(((((((.((((((((.....((((......))))..))))))))(((((((...))).))))((((((..(((...))))))))))))))))......)).))))))))).)))))))))))))))).)))))))))))))..............))).)))))))).)))))))))...)).))))..((((((..(((((((((((((..(((..((((((((((((((((....)))))).......).)))))).)))..........((((((((((....(((((....)))))(((((..(((((((((...((((..(((((.(((((....)))))..)))))..))))(((((...)))))(((((((((((((..(((((((.(((((((..((((....))))...)))).)))...)))))))..((.(((((...)))))))..(((((..(((((.((((((........((.((((((((.((((..((((.....)))).(((((....))))))))).)))))))).)))))))))))))..)))))((((((((((((....))))))).))))))))))))).(((((.((((((..((((..((.....)).))))..))))))))))).....(((..((...))..)))((((((......))))))...))))).))))))).))..)))))....((.(((((.((((.......))))...))))).))(((.(((((.......))))).)))...)))))))))).))).)))))))........)))))).......))))))))))))))))))).))))))......)))))))).((.((((..(.......(((.((.((((..(((..(((.......((.(((((((.((((((...))).))))))).))).))......))).)))..)))).)).)))........)..))))))..((.(((((((((((((................(((.((((..............))))))).....((.((.....))))..(((.(((.(((.((((((((..((.((...)).)).)))))).)))))..)))...))).((((.((((....)))))))).((((..(.(((......))).)..)))).....))))))))))))))))).))))))).)))))))))))).....))))).)))))..))))))......(((...)))...(((((...)))))))))))...))))).)))..)))))))).))))).))).))))))))))))..)))).)))))))))).)).....)))))))....)))))))))).........)))))))))))......)))))......((..(((((((((...)))))))))..))........))))))).)))))...(((((((((((((((....))))).))))...)).))))..............)))))).
Thermodynamic Ensemble Prediction
((((((....((((((.(((((.((({((((((..((((((((.....,(((((..{{{{|{||{{,,,...,..(((((....((((..(...(((((({{((((((,,.....,.(((.((({.,(((((((((..(((((((....)))),{{....}}|{((((({(,{,,|}}}}}},........{{,|{....,)).))(((((........)))))..))).)))))))))..,((((((.(((((({..(.((((.....}))).))))))))..))))))))))}))......,,))))))))))))))).)..))))....)))))..,.(((((..((((((((((((.(((((((((...{,.{{((((...(({,..}}}.,.}}}}||..|(((((((.((.((((...)))))).))..))))).,....{(({(({...,,...,...||||||...)}..((((.(((((.(((((.(((((.(((.....,,.{(((,,,.}}}}...,||||......((((((.(((..(((((......)))))))).))))))..,))}}......(((((((((........)))}....,))))).))))),})))),})).))))).))))......}}}}}}|(((((..,..(((.((((((((...(((((((((((,.....................(((((..(((((.{..(({...}))..}.)))))..))))){((..,|||{|{(((((((.(((......))).))))))}.....,,,.....((((((.((((((.......)))))).)))))).......((((........))))............}.)))).)))))))..)))))))).)))..)))))...))))}))))).))}}))),.,})).))..)))))|||||||}.}},...))))),,..,..,,{{..((((((...((...((((....(((....,}),,))))......((((((.......)))))).....)).))))))..)).((((((((((({,(,((((...|||}..,||((,,,......((((((.....(((((........)))))..))))))...,{{{{{{{{{{,,,.....{{{|||||,,.}||..((((......))))}}))},))))})))}}.},}}},.(((((((...((((.{.((({..(((((((((.((.((......)))))))))))))}))),.))))..........)))))))........,)))))))))))...))))))))..)))))).,{{..(((((...))))).},}.((((..(((.....,.))).))))...)))).)))))))))))((((((...))))))(((.(((.....})),)))(((((..((((((((((((.,...(((((((((((((....))))).)))........{(({(((,{(((((((((((((((({((.(((((....))))).)}.((.((((((((((..((((..((((((,.........,....,..,(((.(({({,{{.|.(({(...,))))||))}))}.}}}((((((.((((((...(((((.(((((((.,..{(((((..((((.((.(((....))))).)))))))},)).,)))))))..)))))))).)))...)))))).,.(((((.({{.{.((((.((((((((..(((((((((((((((((({{(({(,..,||}||,|{||{((((((((((((((((.((((((((((((.((...(((((((.((((.{{..,.....|..|}))))((((((((.,((((((..((((,..,((({(((((,.........,((((|{{.(((((.((((((((....)))).))))...((((.((((((((.(((...(((((((((((........))))..((((.((.(((((((((((....(((((.((.(((((.((...{,....(((((((.((((((((.....((({......))))}.))))))))(((((((...))).))))((((({..(((...))))))))))))))))......}}.)))))))}),)))))))))))))))).)))))))))))))..............))).)))))))).)))))))))...)).}))}..((((((..(((((((((((((..,,,..((((((((((((((((....}))))).......),)))))).)))..,...,,,.((((((((((..{{({{((.,,,|}}}|((({{.,|||{{{|||,,,((((,,(((((.(((((....)))))..)))))..||||(,{((,,,||}}|(((((((((({((,{{{(((((.(((((((..((((....))))...))))},))...))))))),,{(.(((((...)))))}}..{{{({,{({((({((((({.,{(,{.,{{{..,(((((((({{(,{{{.,{{{.||{,.{{,},.,)).}))}}}))),)))))))))))}})))}}}}},,}}}}|{(((((((((((....))))))),)))}}}}}))))).{((((.((((((..((((..({....,)}.))))..))))))))))}.....(((..((...))..))){{((((,,,,,,||||||,{.}}}}}.}}}}))),)),.))))),..,||,{((((,(((,.....,.}}})...)))))}))|||,|||||,,,}...,)))),))),..)))))))))).})).))))))).....,.})))))).......))))))))))))))))))).))))))......)))))))}.((.((((..(.......(((.((.((((..(((..(((.......((.(((((({,((((((...))).))))))).))).)}......))).)))..)))).)).)))........)..))))))..((.(((((((((((((.,..............(({{((((..............)))))))...{((....}}}..((((..(((.(((.,,,.((((((((..((.((...)).)).))))))}|||||{{{.||..|,{.((((.((((....)))))))).,|||.}}.,)}}.}}}))})}).)))))))..,))))))))))))))))).))))))).)))))))))))).....)))))},))))..))))))......||..|||||,,,))))|},})),))))))))...))))).)))..)))))))).)))))}))).))))))))))))..)))).)))))))))).))..,}.)))))))....)))))))))))),.,....||)))})))))......)))))......((..(((((((((...)))))))))..))........))))))).)))))...(((((((((((((((....))))).)))}...)).))))..............)))))).

Transcripts

ID Sequence Length GC content
GCAUUCUUCUCUCUGCUCUCUGAGCUUUCCGUUGCUUCCCUGCCCAUCU… 3588 nt 0.6187
Summary

Predicted to be involved in endosome to plasma membrane protein transport and glucose import in response to insulin stimulus. Predicted to act upstream of or within establishment of localization in cell and vesicle fusion to plasma membrane. Predicted to be located in cytoplasmic vesicle membrane and plasma membrane. Predicted to be active in membrane. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in human post-mortem tissue samples demonstrated that the TRARG1 mRNA, used for adipose tissue identification, was observed in adipose tissue samples with an average relative fluorescence unit (rfu) of 4670 [Broderius et al. DOI:10.1007/s00414-025-03494-2]. A study in humans demonstrated that the TRARG1 is expressed in adipose tissue with an average read count of 6,842 and was part of a targeted 46-mRNA biomarker panel for definitive organ tissue identification using massively parallel sequencing [Hanson & Ballantyne DOI:10.3390/genes8110319].