| ID | Sequence | Length | GC content |
|---|---|---|---|
| CGGCAGGCGCCCGGGGUCCUCAGCGCUGCAGACUCCUGACCUGCCGACU… | 1560 nt | 0.5968 |
This gene encodes a member of the thyrotropin-releasing hormone family. Cleavage of the encoded proprotein releases mature thyrotropin-releasing hormone, which is a tripeptide hypothalamic regulatory hormone. The human proprotein contains six thyrotropin-releasing hormone tripeptides. Thyrotropin-releasing hormone is involved in the regulation and release of thyroid-stimulating hormone, as well as prolactin. Deficiency of this hormone has been associated with hypothalamic hypothyroidism. [provided by RefSeq, May 2013]
A study in mice demonstrated that UVB irradiation induces significant differential expression of specific tRNA-derived fragments (tRFs) and tRNA-derived stress-induced RNAs (tiRNAs) in skin tissue [Fang et al. DOI:10.3389/fcell.2021.707572].