Basic Information

Symbol
BIRC3
RNA class
mRNA
Alias
Baculoviral IAP Repeat Containing 3 C-IAP2 RNF49 MIHC Inhibitor Of Apoptosis Protein 1 Apoptosis Inhibitor 2 CIAP2 MALT2 API2 Baculoviral IAP Repeat-Containing Protein 3 RING-Type E3 Ubiquitin Transferase BIRC3 TNFR2-TRAF-Signaling Complex Protein 1 TNFR2-TRAF Signaling Complex Protein Cellular Inhibitor Of Apoptosis 2 Mammalian IAP Homolog C RING Finger Protein 49 IAP Homolog C Hiap-1 HIAP1 Baculoviral IAP Repeat-Containing 3 EC 2.3.2.27 HIAP-1 HAIP1 IAP-1 AIP1
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Mechanical injury analysis

MANE select

Transcript ID
NM_001165.5
Sequence length
6877.0 nt
GC content
0.3584

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1715.00 kcal/mol
Thermodynamic ensemble
Free energy: -1849.05 kcal/mol
Frequency: 0.0000
Diversity: 1573.38
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((((((.((((((..(((.((((...((.(((.......))).))...)))))))..))))))))))).(((((((.((..(((((..(((((((......))))))).(((((...................)))))......((((......))))............(((((((((.(((((..(((((((((((((((((((((((((.(...(((((...((((((.....((((((((.....((((((((((.(((((((((((........))).))))))))...((((((.((((((......))))))...)))))).......((((......)))).((....))..........))))))))))..(((((..(((((...........)))))..)))))........))))))))....))))))....))))).((((((((((.......((((((((((((((...(((((((((...........(((((((.............))))).))....(((((.(((.................))).)))))...............)))))))))........(((((((((...(((.((...((((((...(((((((((((..((....))..)))))))).........)))...))))))..)).)))..)))))))))))))).))))))))).(((((..((..((((((.(((((((((((((((((((((..((((.((((((...((((.((((.................................((((.(((((((......))))))).))))((((((((((((((...........((.(((((..(((((.(((.((((((((((((..........((((((((((((.(((((.(((.((((((((((..(((........))).((((.......))))((((...))))...(((...(((((((...(((((.((((..........................))))((((((((........)))))))).((.((((.(((((.((((((((.(((((((.....)))))))(((.((((.(((...))).)))).)))..)))).))))..))))))))).))((((((((((..........)))))))))).)))))..)))))))...)))..((((...))))..((((.....((((((...))))))(((...((((((........)))))).)))))))((((((((....(((((((........(((.(((((((.....))))))).)))...........)))))))...))))))))......)))))))))).)))...............((((((((.....((((.((((((((((((((((((((((((............(((((..((((......((((..((((((((((....((((((((((((((((((........))))((((((((....(((((((((((((((((...........))))))....)))))).....)))))))))))))))))))))........(((((...(((((((((((((((((((....))))))).((.(((((((((((((((.......((((((....))))))(((.....))).......((.(((.....))))).........(((((((((..((((.(((.......))).))))....)))).)))))....))))))))))......)))))..))..........))).)))).)))))...)))))(((((......))))))))))).....))))))))))..))))......))))....))))).(((((((....))))))).)))))))))).))))))))))))))..))))..))))))))..............................))))).))))))))))))((((((..((...))..))))))........(((((((.(((((((.....(((((((.........((((((.(((((.........((((.....))))........)))))...)))))).............)))))))....))))))))))))))...))))))))))))....))).))))).))))))))))))))))))))).)))).))))...)))))).)))).((.((((....)))).))......((((((((.((....)).))))))))(((((((((((((((.......)))))).((((......((.(((((((((((...(((((.........)))))...))))))))))).))))))......))))))).)).((((((...))))))....((((..........))))(((((((...)))))))..)))))))))))((((......))))..))))))...((((((((((((((((...)))))))....))))).))))..)))).))))))..))...)))))...(.(((((((.((........))...))))))).)...................)))))))))).....((((....))))((((......))))..........).)))))))))))))))))))))..)))).)))))))))))))).........(((((......)))))..((((((((..((((((....((((((....)))))).(((((......)))))....((.((((((....(.(((.((........)).))).)..)))))).))...(((((.((((((......))))))..)))))........))))))..)))))))).......((((((((((((((((((((..(((((.(((((..((.((((((((....((((((((((.(((..(((.(((...(((.....(((((((...........((((((.....))))))...........)))))))....)))...(((((((((..((((((((((((.........(((((..((((.(((.((((.((((((((((((((((((......((((((((((.......((...............)).......)))))..((((((..........))))))(((((((........(((.(((..............)))))).......)))))))...)))))))))))..))))))))(((((.((.....((((((.(((((((.............(((((....))).)))))))))))))))))))))).........(((.(((((((.........((((...(.((((.....)))).)))))))))))).)))((((((((.....((((((((.(((.((....(((((.((((((((((..((((......))))(((.((((((..((((...........((((((((..(......)..))))))))....)))).)).)))).))).((((((((((((((.((((..(..((.((((((.((((((((..(((.(((((((((((((..((.((..(((((((((.....)))..))))))..((((((...(((...))).)))))).....(((((....))))))).))..))))))).)))))))))..)))).........((((((.((((....((((((.........)).)))).)))))))))).......(((((((((......((((((....(((((........)))))))))))......))))))...)))((((((((((.(((((.((.....((((((((....)))))))).....)).).))))...((......))((((.((((((..(((......((((((((..((((((((((((..((....((((((.(((((.........((((..(((((.((((.(((((((.(((((((.(((((((....)))...........((((..(((((.(.((((........((((((((.(((((((((((((......((.((((......))))))))))))))......)))))..)).))))))........((((((......))))))....((((.....((.(((((.......)))))...))......)))).)))).).)))))........(((((((....((...((((.((....(((((((((.((((((.....(((.(((.....))))))))))))))))).)))).....))))))...)).....)))))))(((((((((..(((.((((((..........((((((((......)))))))))))))).))))))))))))...(((((..((((...((((((((((((......((........))......))))))))))))....((((.....))))..((((((...))))))((((((((........((((..(((((.(((...(((.....)))...))).)))))..))))......))))))))..((((((((((((.........((((((((....((((..((((((.((((((....)))))).((((((..(((((....)))))..))))))...........((.(((((((((((((....)))))))........))).))))).))))))....))))...((((((((.....)))))))).(((((........))))).....))))))))......))))))))))))........))))..)))))...)))).....(((((.((((.((...((((((((((((......))))).....((((.......)))).((((((((...........)))))))).)))))))...)))))).))))).......((((((.......((((((((.(((((((...((............))...)))))))...........((((.(....(((((....))))).....).)))))))))))).........))))))................................)))).)))))))))))))).))))........((((.((...((((.......)))))).)))).........................(((((....)))))..)))))))))........))))).)))))).....))..))))))))))))......(((((......)))))...((((((((((..((((.((((((...(((....))).))))))))))..((((....(((.....)))))))))))))((((..((((.(((((((........(((((((((((((..((((.....))))..)))...)))))))))).(((((.(....(((((((((..(((((......(((((.((((..((((...........)))).)))).))))).....))))).....))))..)))))..))))))...........((((.((..((((((((.(((((((...)))))))..))).........)))))..)).)))).)))))))((....)).))))..))))))))..)))))))).)))...)))))))))).(((((.(((((((.(....).))))))).)))))((((((......))))))...(((((((....))))...)))..............(((((............)))))........)))))))))))))))))))).)).)..)))).))))))))))))))...........)))))))))).)))))..)))))))).))))).))))))))...)))).)))))))))))..)))))....(((.((((((.((((..((((((((((..(((((....)))))..)...)))))))))..)))).((((.(((.((((((((...((((...(((((....))))).)))).))))))))))).)))).)))))).))).........((((((((((((.((((..........(((((..(((((((....(((..((..............))..)))....))))))).)))))....(((((......)))))..)))).))))))))))))..))))).(((..((((((.....))))))..))).)))))))..)))))))))))).)))(((((((....((((((...........))))))..(((((((((.(((((((((......((((((......))))))...))))))).........)))))))))))(((((((.......((((.((((....)))).))))......)))))))(((((.......)))))((((((....))))))...((((((((.........)))))))))))))))..(((((((..((((..(((..((...((((((((.(((........))).))))))))..))..))).)))).)))))))...........))).))))))))))))))))))))..)).))).)))))...)))))).)))))))))).)))))))))..)).)))))))..........((((.((((.......)))).))))......................))))).....((((((((((....((((((((....))))))))....)).)))))))).
Thermodynamic Ensemble Prediction
.,...((({,(((((.((((((..(((.((((.,.,{.(((.......))).}}.}.)))))))..))))))))))).(((((((.((,{(((({..(((((({......))))))}.(({,,.....,.,{,.,...,....,,........{{{{.....|)))}............(((((((({,(((((..(((,(((((((((((((((((((((.(...,,.,,,.(((,(({{{{{{,{{{{{|,.,,{{{{{{{|{(({,,{{((({,{(({{{,,,.{|||,|||,,||}...((((((,((((((,....,)))))),..)))))).......{(({.,,,,.}}}|||||.,,,||,.,}}}}},)))))))))}..{((({,{(((((..,,....,,.))))).}))))|{{{{.,{{||{,.||,....},,},,,}}}}},))))|..,,,,,,.....{.((((((((({((({{{{({{{{{,,,.....}}....{{(((((..,,.....,,..))))).})...,((((({{...|||||||,,{{{{,.,|||..........{(((((({......)))))))).,,,....,,.||||,,,||,.{|....,,,{,..((((((((((((..{,....))..)))))))))}))},{..,.}},.}}}})}},,,,}}}..,},)))))))))))})}))))))),(((((..((..((((((.(((((((((((((((((((((..{(((.((((((...((((.((((...................,..,,....,...,(((({(((((((.....,))}))))})))|((((((((((((((........,..{(.(((({..(((((.({{.((((((((((((..........((((((((((((.(((((,(((.((((((((((..{{{,,{,.,{{|||{((((....,..}}}|{{{|||.||||.,,(((...(((((((...(((((.((((..........................)))}((((((((........)))))))).((.((((.(((((.((((((((.(((((((.....)))))))(((.((((.(((...))).)))).)))..)))).))))..))))))))).))((((((((((..........)))))))))).)))))..)))))))...))).,||,....,}}},,||,,....,{{{{{(,..)}}}}}|,,...((((((........)))))).}}},}}},{{{((((...,{(({{{,.....,,.({(.(((((((.....))))))).))).}}.,......}}}}}}}...}}}}}))),.....)))))))))).))),....{{{....,,}((((((((.{...((((.(((((((((((((((((((((((({{,...,|||,.{((({..((((......((((..((((((((((....{{{{{,((((((((((((........))))((((((((,,..((({{{{{{((({((((.,,,,......}}))))..,,)))))}}},..}}})))))))))))))))))),{{,....||||{...(((((((((((((((((((....))))))).((.(((((((((((((((.......{(((((....)))))}({(.....}}}..,....((.(((.....))))).........((((({{{{..{{{(,(((..,,,,,}}}.}))),,,.})))})))))....)))))))))},....,}))))..))..........))).)))).)))))...}}}},{{{{{......}}}})}}))}}....,))))))))))..))))......))))....))))}.((((({,....))))))).}))))))))).))))))))))))))..))))}.)))))))).............,..,,,...........))))).)))))))))))){(((((..({...})..)))))}........((((((,,(((((((.....(((((((......,,,({((((,{((({....,,...,|||},},}),)},.,||||{|||,,..,)))))).,,..........)))))))....)))))))))))))).,.))))))))))))....))).))))).))))))))))))))))))))),)))).))))...)))))).))}|,{{.{({{....,}},.}}..,,.,{(((((((.((....}).)))))))}({(((((((((((((.......)))))).((((......((.(((((((((((...(((((.........)))))...))))))))))).))))))......))))))).)}.{(((({...})))))...,((((..........))))|((((((...)))))))..))))))))))){(((......))))..))))))...{(((((((((((((({...})))))}...,))))),,))),,)))).))))))..))...)))))...|,||{||||,|{.},,.,,,)).,,)}))}}}.}...{{{,,{{{{{{........)))))),}}}}}{(((,,,,||}},,,{......,))),...,,},..}.))))))))))))))))))))).,))},.)))))))))))))).........{((((......))))}..((((((((,.((((((....((((((....)))))).(((((......))))),,,.{(.((((((....(.(((.{(........)}.))).)..)))))).)}...|((((.((((({......})))))..))))|....,...)))))).,))))))))....|{,({((((((((((((((((((..(((((.((({(..((.(((((((({..,((((((((((.{{,.}|||.{{{...(((.....(((((((....,,,,,..((((((.....)))))).....,.|...}))))))..,.))}.,,(((((((((..(((((((({{{{.........(((((..((((.(((.((((.(((({(((((({((((((......((((((((((.......{(...............)}.......)))))..{(((((..........)))))}(((((((........(((.(((.,............)))))).......))))))),..)))))))))))..})))))))(((({,((.....((((((((((((((....,,.......{{(((....))).)))))))))))))))))))))),........(((.(((((((.....,...{{{(...{.((((.....)))).})))}))))))).)))((((((((.....((((((((.(((.((....(((((.((((((((((..((((.,,.,,}},.{{{.|||(({..((((...........((((((((..{......)..))))))))....)))).}},,}}}.}}),((((((((((((((.((((..(.,((,((((((.{{{{((((..(((.(((((((((((((..((,((,,({{((((((.....)))}.,)}))),,|||{{(,,,((|||.}}}.}}}},)}.},}|||,.....,,,..,,.})..))))))).)))))))))..))))..,,.....((((((.((((....((((((.........)).)))).))))))))))....,,.(((((((((..,...{{(((((({..(((......))))))))))})))......)))))}..,)))((((((((((.(((((.((.....((((((((....)))))))).....)).).))))...,,......}}((((.((((((..(((......((((((((..((((((((((((..((....((((((.(((((......,,.((((((((((({(,((,(((((((.(((((((.((((,{{...,|,|((((((.{(((((((.,{..{,((,{.((((....((({...})))...)))).,}||{,...,|||}{{,|,,|,...}|,))))||}}}.}}}}}}}||......,,,|{||,,,,|,..((((((......))))))....{{,{{{{,.{({{,,{{{{{,...,|,||{,.,,,,..,.||||{,,,,|||}},||}|,..,||||||}.,{{{{,{,,,|,{({({(,,,{,.((((.....,|||}....{||}|||.....,,}))},,}|||.||{||||,.{.{{{.,.,||{{{{{{,..{((((((((((((((((..(((.((((((..........((((((((......)))))))))))))).)))))))))))).))}.)))}}.|,|...((((((((((((.,....{(........})....,.))))))))))))..,.((({.....)))}..||}}}}}}}...}.))).}..})))))).|{{{,...,}}}}.......,.,|||}}}}}.,},,,}}}}}.}}}}}..,|...,,|}|||||||{{({{{{{({{,,,,,,{{{{{,.{{{.....,{||,,|||||{.{{{{{{...,||||||.(({{,,..,{{{|,,,,})))},,|||||,..}}}}}}},.,|.|||{{((((((((....))))))),..,,,,,|}}.}||||.,,,|||...,||,,...{(((((({.....))))))))}}|||)}}},,..,||||{{{,,,||||||}}......}}}}}}}))))),,}}}||||,||||}}|}},}.))))}}...{({{(,(({{.{|,,|{{{{{{{(((({,,,,,.}})))}|||||{,(.......}}}}.((((((((.........,.)))))))).})))))),..}))))),)))),.......{{{(({.......(((((((({(((((({...||..,|,,......)}...))))))}.,{{{{{...}}|||,,....{((({....))))).,,,,}}))}))))))))).........})))))..,......,}}||||,,,,,...........)))).)))))))))))))).})}}........((((.((...((((.......)))))).))))....,,.....,,.}})))......(((((....)))))..))})))))).},.....))))).)))))).....))..)))))))))))).....,(((((......))))),..((((((((((..((((.((((((...(((....))).))))))))))..,{{{....(((.....)))))),)))))}{(((..((((.(((,{{{,..,.,,,(((((((((((((..((((.....))))..)),..})))))))))).(((((.{....(((((((((..(((((......(((((.((((,,((({...........}})),)))).))))).....))))).....))))..)))))..})))))..........{(((,.,.||||{({(((.(((((((...)))))))..))).},......}}})}.,},.)})),},}}}||{,...,)).))))..))))))))..)))))))),)))...)))))))))).(((((.(((((((.(....).))))))).)))))((((((......))))))...(((((({....))))...))).,...........,{{{{............})),,,........))))))))))}}}}}))))),},.)..)))).)))))))))))))).......}}},)))))))))).)))))..))))))))}))))).))))))))...)))).)))))))))))..)))))....(((.{(((((,({{{..((((((((({.,(((((....)))})..},,,))))))))),,)))),((((.((({({((((((...((((..,{((((....))))).)))).))))))))))).)))).,}}}}}.))}{{{....}}|(((((((((((.((((.......,..(((((..(((((((....{{{,.((.,.,,.........)),}))),,..))))))).)))))..,,(((((......)))))..)))).)))))))))))),,))}|||({{..((((((.....)))))),,))},)))))))..))))))))),}),,))(((((((..{.((((((.,,....,}..))))))..((((((((({(((((((((..,,..{(((((......))))))...}}))))).........)))))))))))(((((((.......((((.((((....)))).)))),.....))))))){((((.......)))))((((((....))))))...((((((((.........)))))))))))))))..(((((((..((((..(((..{{...((((((((.(((........))).))))))))..})..))).)))).))))))).....,{,,..})),))))))))})))))))))))..)}.))).)))))...)))))),,))))))))),}))))))))},)),)))))))..........((((.((({.....,,)))}.}}}}....,,,,......,,.,|||.|||||..,{{(((((...|}}}}}||{{{{{{,,,,)})))),}...,}},}}},.....

Transcripts

ID Sequence Length GC content
GGCACGGAAAAGGCCAGGCGACAGGUGUCGCUUGAAAAGACUGGGCUUG… 6877 nt 0.3584
GGCACGGAAAAGGCCAGGCGACAGGUGUCGCUUGAAAAGACUGGGCUUG… 4317 nt 0.3857
Summary

This gene encodes a member of the IAP family of proteins that inhibit apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. The encoded protein inhibits apoptosis induced by serum deprivation but does not affect apoptosis resulting from exposure to menadione, a potent inducer of free radicals. It contains 3 baculovirus IAP repeats and a ring finger domain. Transcript variants encoding the same isoform have been identified. [provided by RefSeq, Aug 2011] CIViC Summary for BIRC3 Gene

Forensic Context

A study in human cadavers demonstrated that the apoptotic thanatotranscriptome in liver tissue shows significant gene expression changes with increasing postmortem interval, where the biomarker BIRC3, an anti-apoptotic gene, was found to be up-regulated (2.8692 fold) in decaying tissues compared to a control [Javan et al. DOI:10.1007/S12024-015-9704-6]. This work provides insight into postmortem gene activity with potential applications in medico-legal investigations. A study in rats demonstrated that the BIRC3 is an apoptosis-related gene upregulated in the cerebral cortex following traumatic brain injury, with expression increasing at 3, 6, and 12 hours post-injury [Shojo et al. DOI:10.1016/j.neuroscience.2010.10.018]. In a separate in-vitro rat organotypic hippocampal culture model, the BIRC3 was identified as an inhibitor of apoptosis protein and was upregulated following a mild (10%) stretch injury, indicating its role in anti-apoptotic processes [Di Pietro et al. DOI:10.1089/neu.2009.1095].