| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGACCGCGAGGGGAGACGGUGCGGGCGGCCGGGAGCGCAGCCCUCCG… | 5170 nt | 0.4803 |
Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in innate immune response and regulation of gene expression. Predicted to be active in cytoplasm. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans developed a target RNA sequencing assay for body fluid mixture deconvolution, where the TRIM58 mRNA contributed the highest read proportions in venous blood but showed cross-reactivity in semen, menstrual blood, and saliva samples [Yu et al. DOI:10.1016/j.fsigen.2025.103416]. The assay, which included microhaplotypes from this marker, demonstrated excellent discriminative capacity in artificial mixtures, successfully detecting all body fluid components and correctly associating most genotypes with their contributors.