Basic Information

Symbol
TRIM63
RNA class
mRNA
Alias
Tripartite Motif Containing 63 SMRZ IRF Striated Muscle RING Zinc Finger Protein Muscle-Specific RING Finger Protein 1 RNF28 Tripartite Motif Containing 63, E3 Ubiquitin Protein Ligase RING-Type E3 Ubiquitin Transferase TRIM63 Tripartite Motif-Containing Protein 63 E3 Ubiquitin-Protein Ligase TRIM63 Iris Ring Finger Protein Ring Finger Protein 28 MURF-1 MURF1 Muscle Specific Ring Finger Protein 2 Iris RING Finger Protein RING Finger Protein 28 EC 2.3.2.27 MuRF-1 CMH31 MURF2 MuRF1
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis

MANE select

Transcript ID
NM_032588.4
Sequence length
1770.0 nt
GC content
0.5220

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-613.30 kcal/mol
Thermodynamic ensemble
Free energy: -643.97 kcal/mol
Frequency: 0.0000
Diversity: 614.72
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.....(((((.((.(..(((..((....)).)))..))))))))(((.((((((..(((..((((((((((....(((..((((((((..((.((((((((.((((((.(((((.....((((((.....))).))).....))))).))))).(((((((((((...)))))......))))))((.(((((((((((((((((...(((((((((((((...........(((.((((((.(((.(((((......))).)))))))).))))))..)))))).)))))))..((..((((((((.((((....((((((((.(.((.((((....)))).)).).....)))))))).(((.(((((.((.(((((((...))))))).))...(((((((((.((.(((.(.((((...(((((...(......)...)))))...))))..).)))..)).))))).))))...((((.((((((....((((.....))))..(((((..........)))))....(((((....)))))(.(((((((.(((((.((.....((((((((((((((...(((.(((((.(((........((..(((.((((((((..........))...(((....(((((.(((((.(((((...((((.......))))...))).......((((((.((.(((....))).)).)))))).)).))))))))))...))).....)))))))))..))...........))).))))).)))....)))))((((((..((((...(((((.(.(((.....))).).)))))........))))..)))).))..((((((((((((((.((.((((......))))))...(((.....(((((((....((.((.(((..((..(((((...(((.((....))..(((((((((...(((...))).((((((.....((..((.((.((((.((.((((..((.(((..(.....)..))).))((((((((..((.((.........)).))..))))))))...........)))))).))))..)).))..)).....)))))).)))))))))..(((.((((.........))))))).)))....)))))..))..))).)).)).....)))))))..)))))))))....)))).)))))))))))))......))))))).))))))).)((((((....))))))))))))..))))..))))).))))))).))(((((....)))))..))))))..))........(((((((((...))))))))).)))))))))....)))..))))).))(((......))).(((((...((((((.(((((((...........)))).))).))))))..)))))((((((....((((((((........))))))))...)))))).(((((........))))).......).)))))))).))....))).))))).)))....)))))).....))))....)))..)))))).)))..(((((((((((...(((((...))))).....)))))))))))(((((((((((.(((.((((((((........)).))))))...((((((..(((((((........)))))))..)))))).((((((....(((((...)))))...))))))..)))))))))))))))))......
Thermodynamic Ensemble Prediction
.,,,....,(((((.((.(..(((..((....)).)))..))))))))|((.((((((..(((..((((((((((....(((..((((((((..((.((((((((.({{(((,((((({{{{{(((((({{...,,.{|||{{...,}||,.,||||{((((((((((,...}}|,|{..{{{{{{{{,...,(((({,,,(({{(((...{((((((,(((((({.{{..,{{{.((((((((((,(((.((((({{,...}})|))}|||||{|{,,,,..,))),))))),|||,{,...{(({...,}}|.|}}},((((((((.{.((.((({....}))).)).|.....)))))))).{{{{{(({(,{,.||{(((,..,},,,}}}}}|,,|||{|||||(,(({(,{,..{{{{|,|((({{,..|.,,...,.,.}}}}}...}})}.||,|}}|,}}.}}}}|||||||..((({,|{{{{{,,.{((({..,,,)))){.(((((......,,..))))).,,||||||,.||||,||{.((((((({(,{{,.,{}}..}|||{{{||,|||||,,,{|||{{{{{|{||||,||.||||||,{{{(({{,{,||}}|,.....}},..||,....,||||.|||||.|||||||}|||||,..,,,)))),.,),,.,.....((((((.((.(((....))).)).))))))....))}))))))),.})))}},.})),}}))))}.,)},..}))}}..)),,,,)},,,))}}}})))}|{{({((..{(((...(((((.(.(((.....))).).)))))........))))..)))).}}..((({(({,{(((((.((.((((,.,..|}||||,..,((({,...{{{{||||...||.||.|||})||,,}))}|..}||||||}}.}))..(((((((((..,({{...))).((((((.....({..((.({.{((({{.,(((({,{,.{((..|,.,..}.,})),||({({(({{..{{.{{.,,,,,,,.}}.}}..}}}}}))}.....,},...)))))}.})))..}}.})..)).....)))))).}}}}}}}})..|||.,|,..,,.,..,.)))))..})}}...,)))))..,..})))}))},......||||{{{.....))))),}}.,})))})})|||||,}|}|{{....,)))}),.,}}))))||{(({(({..{,{(({{{|,,.,..,}))})))),)..}))}}),,,(((((....)))))..}||||{((|,...{|||}(((((((((...))))))))}..|}}}},,,,))})),)))))}}.))}}}|||...}}}.(((((...((((((.(((((((...........)))).))).))))))..)))))((((((({...}))))))}{((({,...))))))...,,,|||{((({...,,,,,,))))))},...,),)))))))).))....))))))})).))}....)))))).....))))....)))..)))))).)),..(((((((((((...((({(...})))),,,..)))))))))))(((((((((((.(((,((((((((........)).)))))}...{((((({{(,(((((........)))))))}.)))))}.((((((.{{.(((({...})))).}}))))))..)))))))))))))),}}......

Transcripts

ID Sequence Length GC content
AGAAUUCGGGCACCAGGAGAAGGAAGCCAACAGGAUCCGACCCGGUGUU… 1770 nt 0.5220
Summary

This gene encodes a member of the RING zinc finger protein family found in striated muscle and iris. The product of this gene is an E3 ubiquitin ligase that localizes to the Z-line and M-line lattices of myofibrils. This protein plays an important role in the atrophy of skeletal and cardiac muscle and is required for the degradation of myosin heavy chain proteins, myosin light chain, myosin binding protein, and for muscle-type creatine kinase. [provided by RefSeq, Feb 2012]

Forensic Context

A study in humans identified the TRIM63 as a core diagnostic biomarker for acute myocardial infarction (AMI) [Hu et al. DOI:10.3390/antiox14121435]. A study in young male Wistar rats demonstrated that extensive scald burn injury induced skeletal muscle atrophy and inflammation, with mRNA expression of the TRIM63 significantly higher in injured groups at 4 days post-injury compared to controls [Quintana et al. DOI:10.1007/s00011-014-0783-8]. In human skeletal muscle from non-burned limbs following severe burn injury, mRNA expression of the TRIM63 was found to be over 3-fold higher in burned subjects compared to matched controls [Merritt et al. DOI:10.1097/BCR.0b013e31827a2a9c].