| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAUUCGGGCACCAGGAGAAGGAAGCCAACAGGAUCCGACCCGGUGUU… | 1770 nt | 0.5220 |
This gene encodes a member of the RING zinc finger protein family found in striated muscle and iris. The product of this gene is an E3 ubiquitin ligase that localizes to the Z-line and M-line lattices of myofibrils. This protein plays an important role in the atrophy of skeletal and cardiac muscle and is required for the degradation of myosin heavy chain proteins, myosin light chain, myosin binding protein, and for muscle-type creatine kinase. [provided by RefSeq, Feb 2012]
A study in humans identified the TRIM63 as a core diagnostic biomarker for acute myocardial infarction (AMI) [Hu et al. DOI:10.3390/antiox14121435]. A study in young male Wistar rats demonstrated that extensive scald burn injury induced skeletal muscle atrophy and inflammation, with mRNA expression of the TRIM63 significantly higher in injured groups at 4 days post-injury compared to controls [Quintana et al. DOI:10.1007/s00011-014-0783-8]. In human skeletal muscle from non-burned limbs following severe burn injury, mRNA expression of the TRIM63 was found to be over 3-fold higher in burned subjects compared to matched controls [Merritt et al. DOI:10.1097/BCR.0b013e31827a2a9c].