| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCCCCCACCCACCUCGUCCGCUCUCUCCUCCUCCUCCUCCUCUUCCU… | 8704 nt | 0.4744 |
The protein encoded by this gene is an E3 ubiquitin-protein ligase that binds with miRNAs and maintains the growth and upkeep of embryonic stem cells. This gene also is involved in the G1-S phase transition of the cell cycle. [provided by RefSeq, Dec 2015]
A study in *C. elegans* demonstrated that the TRIM71 functions as an RBCC protein that prevents expression of the LIN-29 transcription factor, and RNAi knockdown of the TRIM71 synergistically enhanced the precocious developmental phenotypes of *dre-1* mutants [Fielenbach et al. DOI:10.1016/j.devcel.2007.01.018].