| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGCAUGAUGGGGCAUGUGCGGGAGCGCCAGGCGGGGCAUGUAACCAGA… | 1350 nt | 0.6074 |
Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in innate immune response. Located in cytosol. [provided by Alliance of Genome Resources, Jul 2025]
A study in human cardiac tissue from patients with end-stage ischemic cardiomyopathy (ICM) and non-failing controls using single-nucleus RNA sequencing identified the TRIM73 as differentially expressed in lymphocytes when comparing dilated or hypertrophic cardiomyopathies to non-failing hearts and to ICM, but it was not differentially expressed between ICM and non-failing hearts [Simonson et al. DOI:10.1016/j.celrep.2023.112086].