| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUGAAAUCAAGAUGGAGGCUCGCGGCAGCCGCCGGCGCCCGUGAUCCC… | 11460 nt | 0.5337 |
This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
A study in mice demonstrated that the TRIO transcript increased in abundance within 0.5 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267]. In a subsequent forensic validation study, the TRIO transcript (identified by probe A_55_P2006861) was the top individual predictor for postmortem interval (PMI) in mouse liver, yielding an R² of 0.94 [Hunter et al. DOI:10.1016/J.Forsciint.2017.02.027].