| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUACCGCCUCCUGAAAGUUGUGGCUACAGGACAGGCUUUGGCUGCUUUC… | 4691 nt | 0.4381 |
The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
No relevant information is available at the moment.