Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUAGUGGUGCCGACUUCCUGUUGUUUGAGGCCGGGUUGGGGGUGUGCGA… | 1534 nt | 0.4505 |
Summary
The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]
Forensic Context
A study in mice and humans demonstrated that the TSG101 serves as an exosomal marker validated via Western blot on captured extracellular vesicle material, which was isolated using nanomagnetic techniques for a diagnostic platform that achieved 99% accuracy in classifying traumatic brain injury in mice and an AUC of 0.9 in human patients [Ko et al. DOI:10.1039/c8lc00672e]. In a separate murine model of combined traumatic brain injury and fracture, the TSG101 was used for the identification of plasma-derived exosomes, which were found to promote osteoblast proliferation and differentiation, accelerating bone healing [Yang et al. DOI:10.1016/j.jot.2021.09.003].