| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACACACACACCAGCAGCUACACCUACACGCUGACCAUCACAGGCACA… | 1619 nt | 0.5207 |
The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
A study in humans and mice demonstrated that the TSPAN1 is a migrasome-related gene component of a diagnostic signature for acute myocardial infarction (AMI), where it was found to be upregulated in AMI cases in the training cohort [Zhu et al. DOI:10.3390/biomedicines12071626].