| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGCUGAGAGUUUGUGCAGCUGGCCCUGGCUGCCGCCGCUGCCUCGUCC… | 2585 nt | 0.4023 |
The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
A study in humans and C57BL/6 mice identified the TSPAN12 as a potential diagnostic mRNA target for hypertrophic cardiomyopathy (HCM) through LASSO and SVM-RFE analysis of hypoxia-related differentially expressed genes [Yu et al. DOI:10.1186/s40659-023-00451-4].