| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGCGAGCGGCGUCUCCACCAGCAUCUGCCGCGGCCGCCUUUGCCCGAA… | 3347 nt | 0.4777 |
The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
A study in humans identified the TSPAN5 as a gene differentially expressed in the dorsolateral prefrontal cortex of individuals with alcohol use disorder, and its expression was found to be downregulated by the FDA-approved AUD treatment acamprosate [Willis et al. DOI:10.1038/S41380-024-02777-1].