Basic Information

Symbol
TSPAN7
RNA class
mRNA
Alias
Tetraspanin 7 DXS1692E TALLA-1 A15 Transmembrane 4 Superfamily Member 2 TM4SF2 CD231 MXS1 Membrane Component Chromosome X Surface Marker 1 Cell Surface Glycoprotein A15 Tetraspanin-7 CD231 Antigen Tspan-7 MRX58 T-Cell Acute Lymphoblastic Leukemia Associated Antigen 1 T-Cell Acute Lymphoblastic Leukemia-Associated Antigen 1 Membrane Component, X Chromosome, Surface Marker 1 Mental Retardation, X-Linked 58 Transmembrane 4 Superfamily 2b Transmembrane Protein A15 Tetraspanin Protein TM4SF2b CCG-B7 XLID58
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_004615.4
Sequence length
1742.0 nt
GC content
0.4673

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-509.30 kcal/mol
Thermodynamic ensemble
Free energy: -541.16 kcal/mol
Frequency: 0.0000
Diversity: 447.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((.((((...((((((....(((((.................)))))......)))))).......(((((..((((..(.(((((((....))))))).)..))).)..)))))..((((((.......(((.((((...(((.......))))))).)))..........))))))....(((((...((((...((((..(((.(((..(((((((((((....(((.((((((.((((((((..((((((((((((((((.......)))).)))))...........((.(..((((((((.((((.....((((((..((((((((((((...(((.(.((...((((...)))).)).).)))..))))(((((((((((.(((.......(((.....(((((((....((((((.(((((((((((((((((((....)))))..(((((((......)))))))...(((...(((((.((........)).)).)))..)))......))))).))))).........((((((.((((...))))....))))))(((((.(((......))).)))))((((((.............))))))...(((((((...)))))))...(((((......(((((((..(((........)))...)).))))).......(((((((.(((((((.((.(((...)))..)).)).)))))..)))))))...(((.((((((.((((((((((((((.((.(......((...(((.........)))..))...))).)).))))))))))))............(((((..(((...........)))..)))))........)))))).)))....((((....).))))))))....))))))))))..))))))))))...)))..)))))))))))........))))))))..))))))..)))).))))))))..).))...((((((((((.((((.((((.....))))...((((((((((((...(.......)...))))))))..)))).....)))).)).))))))))..((((((((.((.(((((....)))))..)))))..)))))((((.((......))))))....((((((....)))))).....(((((((((..((((((.........))))))..))).))))))........(((..((.....(((......)))...))..))).......)))))))...)))))))).))))...(((((....((.(((....))).)).....(((((...))))).)))))...((((((((.((((...))))...((((..(((((((....))))))).))))))))))))(((.(((((...(..(((((.........)))))..)...))))).)))......)).))).....)))))..((((((((((((((((((..(((((..((((.((((((................((((........)))).)))))).))))..)))))..(((((((...............))))).))....)))))).))).)))))))))....))))).)..))).)))..))))))))...))))))))))).....(((.(((..(((((....((((((((((....)))).))))))...)))))..))))))
Thermodynamic Ensemble Prediction
...{{.((((,..((((((....(((((.................)))))......)))))).......(((((..((((..{.(((((((....))))))).}..))).)..)))))..((((((.......(((.((((...{,,.......}},)))).)))..........)))})),...{{(((...((((...((((..(((.(((..(((((((((((..,{(((((,((((.((((((((..((((((((((((((((.......)))).)))))...,.{,....((.(..((((((({.((((...,.((((((..(((((((({{((.{{,((,,|{||,.,((({..,,,))))}}{||{,,||||((((((({{((.{{,......,(((..,{,{((({((,{,.(((((({((,{(({((((((((((((....)))))..(((((((......))))))).,.(({...{{{((.((........)).)).}})..}}}...,,,}}))),}))})...,,.,,,({((((.{(((...)))}....}|}}}}({((({(((...,,,)}}.}}}}}{(({{{.,|||,,...},,)))))),,,|||||||.,{||||||,...{({({..,,..(((((((.,(((........))).,.))}}})))....,,.(((((((.(((((((.((.(({...)))..)).)).)))))..))))))).,.{((.((((((.((((((((((((((.((.,......,{...{((,,.......}))..}}.,.})).)))))))))))))))........,...(((((..(({...........)))..)))))....,...)))))).)))....({(|....|.}}}}}}}}...}))))))))}},.,,},}}}}},..,))).}))))))}))))........))))))))..)))))),.)))).})))))))..},),.},|(((((((((.((((.((((.....))))...((((((((((((...,.......}...})))))))..)))).....)))).)).)))))))}..{({{{(((.((.(((((....)))))..)))))..}}|||(((({((......)))))),},,{(((((....)))))).....{{(((((((,,((((((.{{,,{...})))))..)))},))))}.,......|||..||.....{,|.....,|||...,,..,)),......)))))))...)))))))).)))).}},||||,...{(.(((....))).)}.....(((((...))))).,|,||,..((({{{{,.{(((,..}}}),,|((((,.{((((((....))))))),))))))}}}}}}{|{,}},}}},....(({{,...,,..,,}}}}}..,{({{{{{({.,.......))}},}})))}))))),.((((((((({((((((((..{(({,.,((({.(((({{................{{{{........,,,,.}))))}.)))).,}}}))||(,{{{{|,,...,..,,,....})))),))...,)))))).})}.)))))))))....,)))).}..))).)))..))))))))...)))))))))}).....{((.(((..(((((....((((((((({....}))),})))))...)))))..)))))}

Transcripts

ID Sequence Length GC content
GUAGUAUGGCAUCGAGGAGAAUGGAGACCAAACCUGUGAUAACCUGUCU… 1742 nt 0.4673
Summary

The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins. This gene is associated with X-linked cognitive disability and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans and mice demonstrated that the TSPAN7 is a migrasome-related gene and a component of a diagnostic signature for acute myocardial infarction (AMI), where it was downregulated in AMI cases in the training cohort [Zhu et al. DOI:10.3390/biomedicines12071626].