| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUAGUAUGGCAUCGAGGAGAAUGGAGACCAAACCUGUGAUAACCUGUCU… | 1742 nt | 0.4673 |
The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins. This gene is associated with X-linked cognitive disability and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. [provided by RefSeq, Jul 2008]
A study in humans and mice demonstrated that the TSPAN7 is a migrasome-related gene and a component of a diagnostic signature for acute myocardial infarction (AMI), where it was downregulated in AMI cases in the training cohort [Zhu et al. DOI:10.3390/biomedicines12071626].