| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGAAGUCCACUCAUUCUUGGCAGGAUGGCUUCUCAUCGUCUGCUCCU… | 616 nt | 0.5146 |
This gene encodes one of the three prealbumins, which include alpha-1-antitrypsin, transthyretin and orosomucoid. The encoded protein, transthyretin, is a homo-tetrameric carrier protein, which transports thyroid hormones in the plasma and cerebrospinal fluid. It is also involved in the transport of retinol (vitamin A) in the plasma by associating with retinol-binding protein. The protein may also be involved in other intracellular processes including proteolysis, nerve regeneration, autophagy and glucose homeostasis. Mutations in this gene are associated with amyloid deposition, predominantly affecting peripheral nerves or the heart, while a small percentage of the gene mutations are non-amyloidogenic. The mutations are implicated in the etiology of several diseases, including amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis and carpal tunnel syndrome. [provided by RefSeq, Aug 2017]
A study in mice demonstrated that transthyretin (Ttr) mRNA expression was significantly increased specifically in the brainstem of animals subjected to asphyxia due to oxygen deficiency (hypoxia) compared to controls, CO2 intoxication, and combined gas exposure groups, suggesting it as a diagnostic marker for this condition [Yatsushiro et al. DOI:10.1007/S12024-025-00981-1].