Basic Information

Symbol
TTR
RNA class
mRNA
Alias
Transthyretin HsT2651 PALB CTS Prealbumin, Amyloidosis Type I ATTR CTS1 TBPA Epididymis Luminal Protein 111 Thyroxine-Binding Prealbumin Carpal Tunnel Syndrome 1 Prealbumin HEL111 TTN
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_000371.4
Sequence length
616.0 nt
GC content
0.5146

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-191.20 kcal/mol
Thermodynamic ensemble
Free energy: -201.24 kcal/mol
Frequency: 0.0000
Diversity: 97.33
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((.(((((((((((((((.((((......((((..(((((.(((((((..(((((((.(((.....((((((((((.....))).))))))).((.((..(((((((((.(((((((((.....(((((..((.(((((...((((((((.((.(((.((((((((((((..(.((((((..((((.(((........))).))))......(.((((.....)))).)..)))))).)..))))).))).))))..)))))))))..)))).....)))))..))...)))))......))))..)).....))).)))))))))..)).))))).)))...)))).))))))).)).......)))..))))...((((....))))..........)))).)))))).((((...................))))................)))))))))))))))))(((.(((.....))).)))...((((((((((((((.((....)).))).))))))))))).((...((((((((((...(((...((((..(........)..))))))).....))))))...))))...))...
Thermodynamic Ensemble Prediction
..{(((((((.(((((((((((((((.((((......((((..(((((.(((((((..(((((((.(((.....((((((((((.....))).))))))).((.((..(((((((((.(((({((((.....(((((..{{.(((((...((({((((.((.(((.((((((((((((..(.((((((..((((.(((........})).)))).....,(.((((.....)))).).,)))))).)..)))))})}).))))..)))))))))..|))).....))))}..}},..))))).....,))}}..}}.....))).)))))))))..)).))))).)))}..}))).))))))).)).......)))..))))...((((....))))..........)))).)))))){((,,....}}}............||}|,..,.,..........))))))))))))))))|(((.(((.....))).})),..((((((((((((((.((....)).))).))))))))))}.{,..,{{(((({{{,....{{...||||.,{,,....|,|,.}}}}},)}....,,}}))},,})}}...,}}..

Transcripts

ID Sequence Length GC content
ACAGAAGUCCACUCAUUCUUGGCAGGAUGGCUUCUCAUCGUCUGCUCCU… 616 nt 0.5146
Summary

This gene encodes one of the three prealbumins, which include alpha-1-antitrypsin, transthyretin and orosomucoid. The encoded protein, transthyretin, is a homo-tetrameric carrier protein, which transports thyroid hormones in the plasma and cerebrospinal fluid. It is also involved in the transport of retinol (vitamin A) in the plasma by associating with retinol-binding protein. The protein may also be involved in other intracellular processes including proteolysis, nerve regeneration, autophagy and glucose homeostasis. Mutations in this gene are associated with amyloid deposition, predominantly affecting peripheral nerves or the heart, while a small percentage of the gene mutations are non-amyloidogenic. The mutations are implicated in the etiology of several diseases, including amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis and carpal tunnel syndrome. [provided by RefSeq, Aug 2017]

Forensic Context

A study in mice demonstrated that transthyretin (Ttr) mRNA expression was significantly increased specifically in the brainstem of animals subjected to asphyxia due to oxygen deficiency (hypoxia) compared to controls, CO2 intoxication, and combined gas exposure groups, suggesting it as a diagnostic marker for this condition [Yatsushiro et al. DOI:10.1007/S12024-025-00981-1].