| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGGUUCUCUUACAUCGACCGCCUAAGAGUCGCGCUGUAAGAAGCAAC… | 2232 nt | 0.5430 | |
| GCAGGUUCUCUUACAUCGACCGCCUAAGAGUCGCGCUGUAAGAAGCAAC… | 1760 nt | 0.5136 | |
| GCAGGUUCUCUUACAUCGACCGCCUAAGAGUCGCGCUGUAAGAAGCAAC… | 1672 nt | 0.5126 |
Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulins. The genes encoding these microtubule constituents belong to the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and is highly similar to the mouse and rat Tuba1 genes. Northern blot studies have shown that the gene expression is predominantly found in morphologically differentiated neurologic cells. This gene is one of three alpha-tubulin genes in a cluster on chromosome 12q. Mutations in this gene cause lissencephaly type 3 (LIS3) - a neurological condition characterized by microcephaly, intellectual disability, and early-onset epilepsy caused by defective neuronal migration. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2017]
A study in mice demonstrated that the TUBA1A gene, used as a stable internal control for qPCR normalization, showed no significant change in expression in injured dorsal root ganglia following spinal nerve ligation [Wu et al. DOI:10.1177/1744806916629048]. In human sepsis patients, post-mortem transcriptome analysis revealed that the TUBA1A gene was downregulated as part of inhibited protein folding, cilium assembly, and cell cycle pathways, and was associated with autophagy across multiple tissues [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].