| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCUCUGCCCAUCCGCGCACCCGGGCUUCGGCUGGAGAGGGCCAGCUCG… | 1389 nt | 0.5594 |
Predicted to enable GTP binding activity; hydrolase activity; and metal ion binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in cytoskeleton organization and microtubule-based process. Predicted to be located in cytoplasm and microtubule. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that in vivo α-particle irradiation of specific liver cell types (Kupffer or endothelial cells) induced distinct gene expression profiles, with the TUBA4B being down-regulated specifically following Kupffer cell-specific exposure [Roudkenar et al. DOI:10.1269/jrr.07078].