Basic Information

Symbol
TUBB1
RNA class
mRNA
Alias
Tubulin Beta 1 Class VI Tubulin Beta-1 Chain Tubulin, Beta 1 DJ543J19.4 Class VI Beta-Tubulin MACTHC1
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mixture deconvolution Individual identification

MANE select

Transcript ID
NM_030773.4
Sequence length
3321.0 nt
GC content
0.4625

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1008.60 kcal/mol
Thermodynamic ensemble
Free energy: -1070.18 kcal/mol
Frequency: 0.0000
Diversity: 645.02
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........((((((((((....)))).((((.((.((((.......((((((((((.(((...)))..))))))))))((((((((((((.(((((.((((((..(.((((.((((((.(((((.((.(((...))).)).(((((((((((((((((..((((((((((((((....((((((.(((((((..((((..(((((((((....))))))).((((........))))((((((((.......((((..((((.(.....).))))(((((....)))))(((((..(((((.((((..((.(((.(((.(((..............)))))).))).))..))))...)))))))))).(((...(((((((((((((...((((((((...(((((((..(((((((((((((((((..(((((.(((((.(((((((((((...(((....)))(((((((((......((.((((((((((.(..((((((.((.((((.(((((((..((((((((..((((.(((((.(((.(((......)))))).))))).))))..)))))...((((....))))..))).))))))).)))).)).)).))))..).)))..))))))).)).))))))))).......))))).((.((((..((((((((........))))))))..)))).))..)))))).)))))..(((((........)))))(((.((..((((....))))..)))))....(((((((.(((.(....(.(((.((.(..(((((((((((.((((((((((((.((.....)).))))))((.(((((((.(((((.(((((((((((((....((.(.((.((((...(((..((((..((((.............)))))))).))).......(((.(((((((((((.((((..(((((.....((((((((.(((.....((.(.((((...((((((...((...(((((((.......))))))).))....((((((((..((((((......((((((((........))))).)))..((((((..........((((((((((((..((((....)).))..)).))))))))))))))))))))))..))))))))(((((((.((((((((((.......))))........))))))...(((((((((....)))))))))........))))))).(((.((((((.....)))))).)))..))).))))))).).))..))).)))...))))))))))..))))........((((..((.(((((((((.(((..........)))..))))))))).)).((((...))))))))....))))))))))).))))))).)).)))..))))....)))))....((((((.((((((((((...(((....))).......)))))))))).......(((((((.(....).)))))))...........((((...))))))))))......))))...))))).))))))))).....))))))))))))....)))))..))).))).))))))))))))(((......)))..........)))))..))))))((((.....)))).....................((((.....)))).....))))))))))).....))))...))).)))(((((.((.....)).)))))..((((((.((((.....(((((((((.............((((.....))))..(((.((.((((..((......))..)))).))))).(((((........)))))((((........)))).))))))))))))).))))))...)))))...)))))))).)))))...))))))).......)))))))).))..))).)..)))))))((..((((......))))..))..........((((((((((..........)))))))))).....((((...(((((.................)))))))))..........))))))................(((((..(((............))).)))))(((.((((((....))))))..)))..(((((..(((((....)))))..)))))))))))))))..))))..)))))))).................))))))))).........))))).)))))))))).).))))))...)))))..................))))))).)))))...((((((((...))))))))..))).).))))))......(((((....(((((((..(((((....))))).(((((((((........)))))))))..........((.(((((((.(((...........))).))))))).))....(((((........))))).(((...))).....(((((((.....(((((..........................))))).....)))))))((((((........))))))..........(((((.(((.((((.((((((...(((((..(((...((((((.....)))))).........(((.((.(((.((.....))))))))))......)))..)))))..(((.(((((.......((((((((....)))).))))((((...((((.....(((((((((((((((((((...........)))))..)))))))....((((((.((((.((((...)))).))))))).)))((((.(((.((...)).)))))))................))))))).....)))))))).))))).))).((((((((((.....((((............................(((((((..((((((.......(((.....(((((((((((...((((.(.((.(((...((((..(.(((.((((((((((((.(((...))).))))...))))).))).))).)..))))...))).))...).))))...))))))))))).....)))........)))))).)))))))((((((((..(((((((.((((((...))))))...))))).))..))))))))..))))))))))))))((((...((((.........))))...))))............))))))....)))).))).))))).......)))))))....)))))))))))
Thermodynamic Ensemble Prediction
.........{(((((((((....)))).((({,((.((((.......((((((((((.(((...}}),.))))))))))((((((((((((.(((((.((((((..(.((((.((((((.(((((.((.(((...))).)).(((((((((((((((((..((((((((((((({....(((((({(((((((..,(((..(((((((((....))))))).((((,......,))))((((((((....,..((({..((((.{.....,.))))(((((....)))))(((((..{((((.((((..((.(((.(((.(((..............)))))).))).))..))))...))))}))))),(((..,(((((((((((((...((((((((...(((((((..((((((((((((((.....)))((,{((((.((((((((({{{((((,.,.,||.,{{|||{|(,{{{{.((.((((((((((.{..((((((.((.((((.(((((((..,(((((((..((((.(((((.(((.(((......)))))).))))).))))..)))))...((({....})))}},),.))))))).)))).)).)).))))..}.)))..))))))).)).,))))))))})))..}))))}{((.((((..((((((((........))))))))..)))).)),})))))).)))))))(((((.,....,.)))))(((.((..((((....))))..)))))....(((((((.(({,(....(.(((.((.{..(((((((((({{((((((((((((.((.....)).))))))((.(((((((.(((((.{{{{({,.....,...,||{{{{{{{,({...(((((((({.,({{.....,,.))}}..))))),,,,},}}|...{(((...(((((((((..((((,.,,,.((({..{{{.(((((((.........(((((.(,{.((.(((((.(((((((((((,(......}}}}}(({(..,,((((((((..((((((,,{.......||||.,..,,..||||}.|||..||||....},..{{((((((((((((((..((((....))},)..)).))))))))))),))),))))))..))))))))|{{{{{|,|{|||{({{{.......}))}........}))))},,.(((((((((....)))))))))|,,.....))))))}.(((.((((((.....)))))).))){{||,...))))....,||{||,.,.........,||}||..,,)}.,,.....}}}}}.,{.{((((((((.(((,.........))}..))))))))},)),,|||...}},}},,,.,,.)))))))).))))))).}...)})))))........))).)))),,)))),.|.|,})))..)))))))))..))))..,{,,...,}}}},.......(((((((.(....).))))))).......((((.(((......))).))))...},.,}},..))))).))))))))).....))))))))))))...,)))))..})).))).}))))))))))){{....(((((((((.{{{...,......)))..))))|,))))}...........,,,,.....,,,,{,,,...,.))}}.,,,,))))))))))).....))))...))).)))(((((.((.....)).)))))..((((((.(((,....{(((((((((.............,{|{...,.}},,..|||.(({((((..((......))..)))}}))),..(((((........)))))((((........)))).))))))))))))).))))))...)))))...)))))))).))))).,.)))))))..,....)))))))).))..))).}..)))))))}}}.{(((......))))..},,,,.......((((((((((,......,,})))))))))).....{(({..{(((((.....{...........))))))))}..........,)))))................,{{{{..{{{........,...}||.}||||(,(,,{{{{,..,,,))))),}},}..|||{({{((((,...})))),)}},,,.})))))))))..))))..)))))))).................)))))))}},,.......))))).)))))))))).).))))))...))))).{................))))))).)))))...((((((({...})))))))..))).).))))))......{((((....(((((((..(((((....))))).(((((((((........)))))))))........,,((.(((((((.(((,,.......,.))).))))))).))....(((((........))))}.(({...})).....(((((((.....(((((..........................))))).....)))))))((((((........))))))......,,..(((((.(((.((((.((((((...,{{{{..{{{...((((((.....))))))...,,.,,{({,.{(,({{.,,.....||||||||||.,|...|||..}}|||..,,{.|||{{.......((((((((....))))}})))((((,..({{{,..,,((((((({{(((((,{({{.....,,,}..,,,,,..,}))))|,||,|||{{{.{((|.{((,...}))).,}))))).))}{{|{.||{.{|...,..,||},,.................})))))).....)))))))),)}))),)),.{(((((((({....,((({................{,,.........||||||...((((((.......(((.....(((((((((((...((((.{.,,.{{{...((((..{.(((.((((((((((((.(((...))).))))}..,)))).))).))).}..))))..,))}.,,.....))))...))))))))))).....)))........)))))).,,}},,,((((((((..(({((({.(((({,...}))})}...))))}.))..))))))))..}))))))))))))|((((...{|||,........}}}}...}))),...........))))))....)))).))).))))).......)))))))....)))))))))),

Transcripts

ID Sequence Length GC content
ACAGUUGUGUUGGGCUCACACCAGUGAACCGAAGCUCUGGAUUCUGAGA… 3321 nt 0.4625
Summary

This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]

Forensic Context

A study in humans demonstrated that the TUBB1 is a blood-specific mRNA marker selected as a candidate gene from microarray analysis [Park et al. DOI:10.1016/j.fsigen.2012.09.001]. In a subsequent human study, a massively parallel sequencing assay targeting coding region SNPs from body fluid-specific genes successfully utilized the TUBB1 for blood identification and donor association in complex mixtures, with the system achieving a discriminatory power for blood of 0.99999999827 [Liu et al. DOI:10.1016/j.fsigen.2024.103066].