| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGUUGUGUUGGGCUCACACCAGUGAACCGAAGCUCUGGAUUCUGAGA… | 3321 nt | 0.4625 |
This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]
A study in humans demonstrated that the TUBB1 is a blood-specific mRNA marker selected as a candidate gene from microarray analysis [Park et al. DOI:10.1016/j.fsigen.2012.09.001]. In a subsequent human study, a massively parallel sequencing assay targeting coding region SNPs from body fluid-specific genes successfully utilized the TUBB1 for blood identification and donor association in complex mixtures, with the system achieving a discriminatory power for blood of 0.99999999827 [Liu et al. DOI:10.1016/j.fsigen.2024.103066].