| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCAGCCCGUCGGUUCCCGAGCGCCUUCCCGGUGACCCCGCAGUGGGUG… | 1922 nt | 0.5614 |
The protein encoded by this gene is a beta isoform of tubulin, which binds GTP and is a major component of microtubules. This gene is highly similar to TUBB2A and TUBB2C. Defects in this gene are a cause of asymmetric polymicrogyria. [provided by RefSeq, Mar 2010]
A study in humans demonstrated that the TUBB2B was upregulated in the subcutaneous adipose tissue of heavier monozygotic co-twins compared to their leaner siblings, indicating its association with cellular protein metabolic processes in the context of obesity [Muniandy et al. DOI:10.1038/ijo.2017.95].