| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCAGACCCCUCUGAGGAUGGAGCAGGAGCUGGCUGCCCUGAGGCUGCA… | 1910 nt | 0.6089 | |
| CUCAGCAGCCAGCCCGGCCCGCCCGCGCCCGUCCGCAGCCGCCCGCCAG… | 1706 nt | 0.6219 |
This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Oct 2010] CIViC Summary for TUBB3 Gene
A study in mice demonstrated that acute alcohol exposure during neurulation induces rapid transcriptomic changes in the rostroventral neural tube, with the TUBB3 being up-regulated (+0.31 Log2FC) 2 hours post-exposure, indicating its involvement in cilia biogenesis pathways perturbed by alcohol [Boschen et al. DOI:10.1016/J.Alcohol.2022.09.001]. In human postmortem prefrontal cortex, coordinated expression networks associated with lifetime alcohol consumption were identified, revealing systematic transcriptome organization changes related to neurophysiological targets of alcohol [Farris et al. DOI:10.1038/Mp.2014.159].