Basic Information

Symbol
ACKR2
RNA class
mRNA
Alias
Atypical Chemokine Receptor 2 CCR10 D6 CMKBR9 CCBP2 CCR9 Chemokine-Binding Protein D6 Chemokine-Binding Protein 2 C-C Chemokine Receptor D6 Chemokine Receptor CCR-10 Chemokine Receptor CCR-9 CC-Chemokine-Binding Receptor JAB61 Chemokine (C-C Motif) Receptor 9 Chemokine Binding Protein 2 Chemokine (C-C) Receptor 9 Chemokine Receptor D6 HD6
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_001296.5
Sequence length
2990.0 nt
GC content
0.5023

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-950.10 kcal/mol
Thermodynamic ensemble
Free energy: -1001.14 kcal/mol
Frequency: 0.0000
Diversity: 575.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((.......((((...)))))))))).)))))........((((.(((((((((.(((((((((.........)))))..(((((.((((.((((....)))).......((((((....)))))).....(((((...(((......)))...)))))))))))))).....(((((((((......(((((((...((.(((((((((.((......(((((((((((((.(((((....))))).))(((((......)))))............))).)).))))))((((.(((...))).)))))).))))))))).)).))))..))).......))))))))).....(((((((......)))))))))))..))).))))))))))..(((((((..(((((((((...(((...)))(((((((((.......)))))))))((((((((((...((((((((........(((((....((((((...)))))).((((((((((((((.(((((.(((.(((((((.((((.((.((..((((..((((.....................))))...............(((((((((((((((((...(((((((((..(((((((((((((((........)))))((((..(((((.....))))).))))....(((((((((((((.((.(((((((.(((((.....((((((((((((((......)))).)))....)))...))))(((((((.....)))))))......))))).)).))))))).((((((((.........))))))))..((((((....))))))...........((((((((.((((..((..(((....)))..))..).))).))))))))..((((((.((..((((((((..((((........))))...)))))))).)))))))).))))))))))))).........(((((((...(((((((.((((..(((.......))).)))).))))))).))))))).....)))))...))..)))..))))))))).....(((((..((...........)))))))(((((((((((((..(((((((((((((((....(((.((((((.((((..(((...((.((.(((((((((.....)))))..)))))).))....)))))))...((((.(((.(((((((...))))))).......((.....)).)))))))))))))..)))))))..)))))).)))))..)..........(((....))))))))).))))))....((((((((...((((((...))))))((((((((((...(((((((..(((..((((((((((.(((...((.(((((.....))))))).))))))...........))))))))))..)))))))))))))).)))...(((((....))).))...................(((((((((((....)))).......((.(((......)))..)).....(((((((.((((........(((.(((((((..((..((..((((((((((...........((((((............................(((....((((..(((..(((((((((...........)))))))))...)))..))))...)))))))))......(((((.(((((((((........(((((((.(((.......))).)))))))......((((((((......(((....)))......))))))))...((((((((((.....................................((((((...))))))...((((((((....(((((...((((((((((((((.((((..((((....(((.......))).....(((....(((.(((((((....)))))..)).)))......((.(((((....))))).))(((((...........))))).(((((((((.......(((..(((((((.((.....((((((........))))))....)).)))))))(((((......)))))...((((((((......))))))))..............((((((...))))))((((............((((((..((((((((((......)))))))))).))))))............))))..))).....)))))))))...(((.....)))(((((((((.......)))))).))).........)))..........)))).)))).....((((...(((((......))))).))))..))))).......))))))))).....))))).....))))))))......((((((.......))))))......))))))))))))).)))))).))))).))).)).)))))..))......))..)))))))))).....)))).)))))))..)))))))((((((((((((......)))))))))))).((((((.......))))))...)))))))).))))).............)))))).))))))...))))..))..)).)))).))..)))))....)))..)))))...)))))).)))).))))..)))))(((((....((........))......))))).....((((..((...))..))))))))))))..((....)).(((((((.......((((((.((((((((.....)).))))))....)))))))))))))........))))))))))((((((..(((((.((((.....(((((((((........)))))).)))...........)))).))))).....))))))...))))))).....))..)))))))
Thermodynamic Ensemble Prediction
..,{{(((,(((,...,{((((,...{||||||,,|,|,|,|{{{,{{{||||{,(((((((,,.,(((((((({||.,,...{{|,,.|(({|||((({.((((....)))).|||...((((((....)))))).....{{{{{,,,{((,....,))}...}}}})}}},,||||.,.,.{((({({((,,...,(({((({...((,{({{{((((.{,,,,||||{{,,,,||||,{||||||||,.||||}.}}}))|))},))}},,,,.,,.........})).}},})))))}}}},}....}})})))}))),})})))))),)),}})}..,,|,,..,,.|||}}}},,.....(((((((......))))))),,,|{{|||,,||,,,.......,,,|||}}||||{{(({.{{,((,..|||{((((((((.......))))))))|((((((((((...((((((((..{{{{{,(((((....((((((...)))))).((((((((((((((,(((((.(((.(((((,{.((((.((.((..((((.,{,{,.....................})}||,.............(((((((((((((((((..,(((((((((..(((((((((((((((........)))))((((..(((((.....))))).)))).{..(((((((((((({.((.(((((((.(((((.....(((({{((((((((......)))).)))}...,}}...)))){((((((.....)))))))......))))).)).))))))).,(((((((.........)))))))|.{((((((....))))))}}.........((((((((.((((..((..(((....)))..))..).))).))))))))..(((({({((..((((((((.,((((........)))).,.)))))))).)))))))}.,)))))))))))).........(((((((...(((((((.((((..(((.......))).)))).))))))).))))))).....)))))...))..)))..))))))))).,.,{(((((..{,..........,)))))))|((((((((((((..(((((((((((((((....(((.((((((.((((..(((...((.((.(((((((((.....)))))..)))))).)).}..))))))),,|{{,,.,,{.(((((((...))))))).......,{.....}},)),,,,}))))))..)))))))..))))))})))))..)..........(((....))))))))).))))),....((((((((...((((({...})))))((((((((((...(((((((..((,,.{(((((({{.{(((,,.((.(((((.....))))))).}})))}.,,}..,,...))))))))))..)))))))))))))},)))...(((({....))).))...................{(((((({{{(....||||,......{{.{{{......)))..)).....(((((((.((((........(({{(((((((,,{{..((..((((((((((...........,{{{,,.......................,,.{{(((..,.((((..(((..(((((((((..,,...,}..)))))))))...)))..)))).}.)))))})))......(((((.(((((((((........(((((((.(((.......))).)))))))......((((((((......(((....)))......))))))))...{(((((((((.....................................{(((((...)))))}.,,{(((((((.,..(((((...((((((((((((,,.((((..((((....{,,......,|||.....{,|....(((.(((((((....)))))..)).)))......{(.(((((....))))).)}(((((..,....,}..))))).(((((((((.......{{,..(((((((.{(,,,,,(((({{.......,))))))....}},)}))))){((({......})))}...(((({(((.,....)}}|)))),,,...,....,.{(((((,...})))))|{||............((((((..((((((((((......)))))))))).)))))),,,},.......,,,....}}.....}))))))))...(((.....)))(((((((((.......)))))).))).......,,}),.......,}.)))).)))).||,...,,,,.{((((......,,}}}.))}}..,)))}.......))))))))).....)))))..,..))))))))}.....{(((((.......)))))}......))))))))))))).)))))).))))).))).))}}))))..))......}),.)))))))))).,...)))).)))))))..)))))))((((((((((((......)))))))))))).((((((.......))))))...)))))))).))))).............)))))).))))))...))))..))..)).)))).})..)))))....)))..))))).,.)))))).)))).))))..))))}{((((....((........))......)))))}}}}}((((..({...})..)))))))))))),{({....},.(((((((.......((((((.((((((((.....)).))))))....))))))))))))).....,}}))))))))))|,,,,,..,,{{,.,,,.......||||||||..}}.}}}})),,)}),,..||{{{..,{|}||{|},,,.,,}},,))),.}}))))))),,...})..)))}}},

Transcripts

ID Sequence Length GC content
CUUUCGAUUGUAGCAUUUCUCCUUUCAGGAUACAGUACGGGAUCCUUUC… 2990 nt 0.5023
Summary

This gene encodes a beta chemokine receptor, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptor-mediated signal transduction are critical for the recruitment of effector immune cells to the inflammation site. This gene is expressed in a range of tissues and hemopoietic cells. The expression of this receptor in lymphatic endothelial cells and overexpression in vascular tumors suggested its function in chemokine-driven recirculation of leukocytes and possible chemokine effects on the development and growth of vascular tumors. This receptor appears to bind the majority of beta-chemokine family members; however, its specific function remains unknown. This gene is mapped to chromosome 3p21.3, a region that includes a cluster of chemokine receptor genes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the ACKR2 was uniquely downregulated in the striatum at 2 days post-traumatic brain injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528].