Basic Information

Symbol
TWIST1
RNA class
mRNA
Alias
Twist Family BHLH Transcription Factor 1 H-Twist BHLHa38 BPES2 TWIST CRS1 SCS Twist Basic Helix-Loop-Helix Transcription Factor 1 Class A Basic Helix-Loop-Helix Protein 38 Twist-Related Protein 1 BPES3 ACS3 CRS Blepharophimosis, Epicanthus Inversus And Ptosis 3 Twist Homolog 1 (Drosophila) TWIST Homolog Of Drosophila B-HLH DNA Binding Protein Saethre-Chotzen Syndrome Acrocephalosyndactyly 3 Craniosynostosis Twist Homolog 1 BHLHA38 SWCOS CSO
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_000474.4
Sequence length
1630.0 nt
GC content
0.5718

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-629.20 kcal/mol
Thermodynamic ensemble
Free energy: -661.55 kcal/mol
Frequency: 0.0000
Diversity: 600.73
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((.(((((..((..((((...((((((.(.(((.((.......))..))).)))((((((((.(....((((((...(((((((((((((((((..(((((..........)))))..((((((((((((..(((((.(((((((((((((.((.....((((.(.((((((.((((.((((((..(((((((.((((((.(((((......))))).)..(((..((((.((.((.((.((((((((((((.(((((((.((...((..((((....(((((..((((.((...)).)))).)))))))))..)).)).))..))))))))))))))))).)).)).)))).))...)))...((....))))))))))).))).((.((.((.(((((...)))))..)))).)).(.(((..(((.(((....)).).))).))))))))))))).).))))))).)))).)))))))).)))))))..))))).))))....((((.((.((((......))))..)).))))...(((.(((((((((.(.((.((.((.((.((((.(.((....)).).)).)).)).)).)).)).).))))))))).)))..((((((((((....))))).((((((((((...((((((((((((((((((.....).))))......))))))).))))))((.(((......))).)).((((((....((....(((((.....)))))....)).....))))))..))).))).)))))))))......((((((((((.((..(((.....)))..(((.(((.(((((.((((.((((...))))...)))))))))..))).))))).))))))))))))))))))...)))))...(((((.............)))))((.((((((.((((...(((..((((((.(((((((((((((.(((((......))))).))).)))).))))).).))))))..)))......................(((......((((((........)))))))))....................)))).)))))).)).......))))))))))))......(((((((((.......)))...))))))))))))......).)))))))))))).))))..))..)))))....(((((((((((((((((((((((.((((((((.((((((((..........))))))))))..(((((..(((....)))..)))))......((((.(((((((((((.(((....)))..))))))...)))))...))))..(..((((((((((((.(((.....)))))).............(((((..(((((((.((......))..))))))).)))))...........)))))))))..))))))).)))))))))...))))))))...))))))....(((((((((((((((((((...)))...(((((..(((((.....)))))..)))))(((((....))))).........((((((......)))))).))).)))))))))))))...........)))..
Thermodynamic Ensemble Prediction
..(((.{((((,{(({{(((((,{(({,{{.{,{{(.{(,...,{{||..}))}))}|||||||{|({{{,({{,{|}}}|((((((((((((((({..{((((,.........|{|||{{((,,((((((((.(({{(((((((.(((((((((({({.{((((({({(,...|}||((.(((,(((((,((,{((((,(((((((,((((...(((((.((((.(((({(((((.((.({.((((((((((((.(((((((,(({{.((,{{(({....(((((..((((.((...)).)))).)))))})))}.)).)).))..))})))))))))))))),)),||{||,........(((..((....)).)))....|{{.,.,}))).((..((.(((.((.....)).))).))..))..(({{(((....}}.,,))).))))))))),)))),)))))),..)))).,))))))).))))).)}.)))))}))}),,,.((((.((.((((......))))..)).))))....,|}|}}},})}}.},))))})),)}}}))}}))),)).)))))})).,},.},,),})})))))))}{{|(({{,{{{..,||}}|||||.,,,))|))|({{.,,||||...(((((((((((((((((,,,...),))))......))))))).)))))),|,(({.,.,,.},}||.,{{(({(,,{,(,...,(((({.....,}}}}...,}}..}}|}}}|||,.||{.....}}}}}}},,,.||.,{(((((((((.({{.{{{,{{{.,,}|.,{{.(((.(((((.((((.{{({...}})},,.)))))))))..))).))))).)))))))))}))))))))}.,)))))..,|||((,({{,.,..|.,,|}||,{{.{{{{{(,((((...(||..((((((.(((((((((((((.(((((......))))).))),)))},))))).).)))))).}))).......................,{{......{(((({.{{,.,,.{,.,,......))..,.}}}.,}))},.,})),)))))),)).......}))))))))))}...,,,||||||||{.......}}}{,,|}))}|||}||,......,.}},,)),))))..}}}}..}),.)))))....((((((((((((((,{{(((((((((((((,..{{(({{((,,,.{{{{{{||,,}}}}}}..(((((,.(((....)))}.)))))...,,,(,,,,|||,,{{((((,{,{....|||,.}}||||{{,||}|,...}}}}..,..{{||||||||||,|,{....,}}}}}),,,}}}}}},,..{(((,..(((((((.((......,,.,))))))).,}))),,||||,.,,,||}}}}})),}))))))).)))))))))...)))))))),..})))))....(((((((((((((,((({{...))}..,(((((,,{{{{{..,,,))))}..,|||,(((((....))))).}}}.,,.,|,||||.,,}}}}},},,.})).))))))))))))).,.........)))..

Transcripts

ID Sequence Length GC content
AACUCCCAGACACCUCGCGGGCUCUGCAGCACCGGCACCGUUUCCAGGA… 1630 nt 0.5718
Summary

This gene encodes a basic helix-loop-helix (bHLH) transcription factor that plays an important role in embryonic development. The encoded protein forms both homodimers and heterodimers that bind to DNA E box sequences and regulate the transcription of genes involved in cranial suture closure during skull development. This protein may also regulate neural tube closure, limb development and brown fat metabolism. This gene is hypermethylated and overexpressed in multiple human cancers, and the encoded protein promotes tumor cell invasion and metastasis, as well as metastatic recurrence. Mutations in this gene cause Saethre-Chotzen syndrome in human patients, which is characterized by craniosynostosis, ptosis and hypertelorism. [provided by RefSeq, Jul 2020]

Forensic Context

No relevant information is available at the moment.