| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGGAAGUGACGACAGGCGUGCCCUUGACAGGCAGGGAGGGCUAGGCUG… | 1336 nt | 0.5636 |
This nuclear gene encodes a mitochondrial member of the thioredoxin family, a group of small multifunctional redox-active proteins. The encoded protein may play important roles in the regulation of the mitochondrial membrane potential and in protection against oxidant-induced apoptosis. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the TXN2 was significantly upregulated in a caecal ligation and puncture-induced sepsis model, with increased protein and mRNA expression levels confirmed by Western blot and RT-qPCR [Tao et al. DOI:10.1007/s10753-025-02346-w]. In human studies, the TXN2 was identified as a key diagnostic biomarker upregulated in sepsis patients through transcriptomic and single-cell RNA sequencing analyses, showing predominant expression in monocytes and other immune cells and strong diagnostic performance in ROC curve analyses [Lu et al. DOI:10.3389/fimmu.2025.1543517].