| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUUUGUCUACUUCCUAUUUGAGAUGUUAGUAGAGAACUGUCCUGGG… | 2610 nt | 0.4345 | |
| AAACUAACCCCUCUUUUUCUCCAAAGGAGUGCUUGUGGAGAUCGGAUCU… | 2905 nt | 0.4375 |
This gene encodes a thioredoxin-binding protein that is a member of the alpha arrestin protein family. Thioredoxin is a thiol-oxidoreductase that is a major regulator of cellular redox signaling which protects cells from oxidative stress. This protein inhibits the antioxidative function of thioredoxin resulting in the accumulation of reactive oxygen species and cellular stress. This protein also functions as a regulator of cellular metabolism and of endoplasmic reticulum (ER) stress. This protein may also function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
A study in humans using integrated single-cell transcriptomic datasets identified TXNIP as a core diagnostic biomarker specifically enriched in high oxidative stress (HOX) cardiomyocytes following acute myocardial infarction (AMI) [Hu et al. DOI:10.3390/antiox14121435]. This gene demonstrated stable diagnostic capability in independent validation cohorts, with an area under the curve (AUC) of 0.716, and was significantly upregulated in AMI tissue compared to controls, indicating its role in oxidative stress sensing and response.