| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGUAGUAGUAGCUGGAAAGAGAAAUCUGUGACUCCAAUUAGCCAGUU… | 2062 nt | 0.4500 |
The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008] CIViC Summary for TYR Gene
No relevant information is available at the moment.