| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUCUCCAGGAAGAGAGCUGUGACCAGCAGCGUCCCUUAUUCGCUUG… | 3304 nt | 0.5820 |
The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme is a retinoid target that triggers promyelocytic leukemia (PML)/retinoic acid receptor alpha (RARalpha) degradation and apoptosis in acute promyelocytic leukemia, where it is involved in the conjugation of the ubiquitin-like interferon-stimulated gene 15 protein. [provided by RefSeq, Jul 2008]
A study in human heart tissue from sudden unexplained death (SUD) cases identified the UBA7 as a differentially expressed gene, specifically upregulated in the "secondary condition" SUD subgroup compared to heart-healthy deceased controls [Neubauer et al. DOI:10.1007/S00414-025-03414-4].