Basic Information

Symbol
UBA7
RNA class
mRNA
Alias
Ubiquitin Like Modifier Activating Enzyme 7 UBE2 D8 UBA1B UBE1L Ubiquitin-Like Modifier-Activating Enzyme 7 Ubiquitin-Activating Enzyme E1 Homolog UBA7, Ubiquitin-Activating Enzyme E1 Ubiquitin-Activating Enzyme 7 UBA1, Ubiquitin-Activating Enzyme E1 Homolog B (Yeast) UBA1, Ubiquitin-Activating Enzyme E1 Homolog B Ubiquitin-Activating Enzyme E1-Related Protein Ubiquitin-Like Modifier Activating Enzyme 7 Ubiquitin-Activating Enzyme E1-Like Ubiquitin-Activating Enzyme-2 EC 6.2.1.- UBE7
Location (GRCh38)
Forensic tag(s)
Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_003335.3
Sequence length
3304.0 nt
GC content
0.5820

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1341.80 kcal/mol
Thermodynamic ensemble
Free energy: -1398.04 kcal/mol
Frequency: 0.0000
Diversity: 799.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((...))))))).(((((.....)))))...((((....(((((((..((.(....((((((((.((.((((((((((..((((((((((..(((.((((........(((((((........((((((((((((((......((((((((((((((((((((((((..((((((..(((((..(((.((((...((..(((((..((((((((.((((((.((((((((........(((((((((.(((((.(((((((((.((.((((.((.(((((.(((...))).)))))..))..)))).)).)))))))))..)))))(.((....)).).))))))))).....(((((((((((..((((((((((((....))))...(((((.((.(((.....))).)).)))))..(((((((((.(((....))).)))))))))(((((....)))))...((((((.((((((((....)))....))).)).))))))..))))))))..))))))).))))..((((((((((..((((((.(.(((((((..((.(((..(((.((((((...((..((((......)))).))...))))))..)))(((((((((((......((((((.((...(((((.....))))))))))))))))))).)))))....)))))..)))))))).)))))).......((((((...))))))..((((((...))))))..((((((..((.(((((.((((((((.(((.(.(.((((((((((((.((((....((((..(((((.(((((...((((((((((((((..((((.((.(((((((((((((.(((((........)).))).))......))))))).)))).)).)))))))))..)))))...))))..)))......(((((((...))).)))).)).))).)).))))((((..(((((....)).)))...)))))))))))))).)))))).)))))..(((((...)))))(((((((.(.((.((...(((((((..((((((.((((.(((((((((....)))).((((((....)))).))..))))).)))))))...)))..)))))))...)).)).).)))))))......))).)))))))....))).)).))))))..))))).)))))))))..)))))))))).))))))))(((((((((...)))))..)))))))))..))..))))..)))..)))))......))))))..)))))).)))).)))))(((((((..........(((((((((.((((((.(((...(((((((...))))))).))).)))))).))....)))).)))))))))).......(((...)))......))))))))).((((((......))))))(((((((.(((((....)))))..))))))).....)))))).))).)))))..))))))).....))))))))))))))))).......(((((((((((.((((..((..((((.(.(.....).).)))).)).)))).))))).(((((((((((((((....(.((((.....)))).)....((((((((...)))))))).)))))))))).((((......((((((......)))))).....))))...((((((((((.....)))(((((((........)).))))))))).))).(((((.((((.((((((.....))))))..)))))))))((((.(((.....))).)))).....(((((..(.((((.(((((((....((((.(((.((.((((((((....))))...)))).)).))).))))(((.......)))))))))))))).)..))))).))))).))))))..))))).))))))))))))).))......).))..)))))))....(((((.((((((.(((.(.((((((...)))))).))))..(((((((.((.....))............((((..........))))))))))).((.((((.........))))))((((....((.((.(((((((((((.......((((((((((..((....)).))))).)))))(((((((..((((.(((((.......)))))...)))).....((((((((((((((((((...........))))))))(((((.((........((((((..(((..(((((....(((.........))))))))..))).))).)))......)))))))...((..(((((((((.......(((.(((((......))))))))(((((((((((..((((.(((((((((((.((((((((...(((((((((..(((.(((.......((((((...))))))..((((((........)))))).(((((....)))))))).)))..)).)))))))......(((.(((((((((((((((((((..((..(((.....))).....(((((.(....).)).)))...))..)))..))))))).).)).))))))..)))))))))))..)))))).)).)))...(((((....((...))....))))).))))..........))))))))))).......))))...)))))..))..))))))))))..(((((((...))))))).((.((((..((((((.((..((((.....((((((.(((((((....(((((((.......((((((........(((.((((((((..........(((((.(((.((((((((((((((((((.....))))......))))).))))))..)))....))))))))((((((((((..(((((.((((((((((((((........))))((((.((((((((.(((.((......)).)))..))))))))))))......((((((...(((((((((...(((((.......)))))...))).))))))....))))))))))))).)))...)))))..))).)))..))))))))))))..)))))))))....)))))))))))).)).)))))).....)))))))))))).)))))).((((((((((((.((......)).))))))..))))))..))))))).))))))))))).))))...)))))))))).))))).....(((((....))))).))))..
Thermodynamic Ensemble Prediction
(((((((...))))))).(((((.....)))))...({({....({..(((.{{,{{,..(((((((..,((((((((((((((...(((((((.((((..(((((.((((..(((((((......,.((((((((((((((....,.{(((((((((((({((((((((((..((((((,(((((,..(((.(({{...((,.(({{,..((((((((.((((((.(((((((({{..((((..,))))..}}{((((((,,((((({(({(((.{((((((((,((({{||||{(((({({(((({{{..{{({||||}|||{{{((((({(((({,||,|.,..{||{,|.{{..(((((((((((..(((((((({{((,,.,)))).,,(({((,{{.|||...,,})},)}.})})),.(((((((((.(((....))).}))))))))(((((....)))))...((((((.((((((((....))).}},},}.)).))))))..))))))))..))))))).))))..||,|{{||||..((((((.(.(((((((..((.(((..(({.((((((...((.,((((.....,)))},))...))))))..))}(((((((((((...,,{({({(({({...((({{,...}))))})}))))}})))))).)))))....)))))..)))))))).)))))).......((((((...))))))..{((((,...}}}|||.,((({,.....}||,,|.{|||||}}.|}),}...((((((((((((.((((.,{{{((({{{(((((....,..)||||||{,|||||({{({,,((({(({,((({{{{{{{{{{{{.|||||,,|}.}}}.},.,..,.})))))})}},|,||,|||||||||,||||}|...}|||..,.)}},},.{{({{{{...}}}.}))).{|{|{|,,,,},,}|{||},|||||,,}})),)))},.}}}}))))))))))}})))))})))))}.|||{,,}})))))|,,,(((((.,.}}}}}}||||,,|},||||,..||||}|||||||||}}}})}|}.{{((((....)))).},}}}},})})))))))))})))}})))),,)}.))))),{|.||||,||.....|||,{||..,.,}}},)))....,.}})).))})),.,,,}}))))..)))))))))).))))))))|(({{{{((,||}},||{{||||||}}}.})},})))).,})},,}}}}}}}....))))))..)))))).)))).}))))(({(((,.........,(((((({{{.((((((.(((...(((((((...))))))).))).)))))).}}.,..}))).)))))))))).....,,||{...}))..,,,,))))))))}.((((((......))))))(((((((.(((((....)))))..))))))).,...)))))).))).))))).,)))))))(((....)))..)))))),}))..)))).))))))),((({({,({{((..((((.(.(.....).).)))).},})))).),))}}|(((({{(((((....(((.{..(((((.....((.(((((((((((((((((((((((((((,......))).,......((((((......))))))..{{,{{({,{{{{.{{{.{{{....,|||,||||||........,,,))}}})))),})).))))))))))),((..(((({{{(((((((((((({{..((((.(((.....))).))))....(((.((((.{{.((((((((({....((((.(((.((.((((((((....))))...)))).)).))).))))((((...(((((((.((((.(((((((((.(((((.((((((.{.{,,,,,(((((((,{{{{{{||,,,..{|,.,||}|.((((.((.(((......))).)).)))).,{((({,|,,|..|||.{(({..(((((((.(||,...,,............{{({........,.}))))))))))}))).}}}..,}}}}},||||...,{{({....}}))),,,))))}...,}).).)))))).))))))),})},).)))...)))).))))))).)))).........}))))))))).}})))).))).((((((((((((((((((...........))))))))(((((.((........{{((((..(((..((({{...,{{{,,,.....,))})))))..))).)))},)}......)))))))...{{..(((({{{{|.......(({.(((((......)))))}))((((((((((({{((((.(((((((((((.((((((((...(((((((((..(((.(((.......((((((...))))))..((((((........)))))).(((((....)))))))).)))..)).)))))))......(({.(((((((((((((((((((..((..(((....,))|.....(((((.,....).)),,))...))..)))..))))))).).)).)))))).,)}}))))))))..)))))).)).)))....,,((....||.}}))}}..,||||{,,,..}}..,,,..})))))))))).......)))),..)))}}..,}..)))))))))),,..}}),.)))))))))))))))))...})((((((({.((((((((....))).).))))})))))))))))))),...}))).)).....))))).}.)))((.....))....((({{{(((.,{{(((((((((((,,{(,....,,))......))))),})))))..))}....))))))))))))))))))|((((.((.(((.((((,{(((........))))))))))).)).))))}{.((((((.....(((((((((((,(((((.,,.{.((((....)))).|,||...}})))|{(((((((((((..(((((((.(.(((..(((((((((...))))...)))))....)))))))))))..))))))))))).)).,}.))))))))))).((((((({..{.((...(((((((..((((((........)))..)))..)))))))...})})))))))).((((....))))...))))))}..)))))))..))),,))).,..)))))))...,,}.,,.))).)}.,)}))..

Transcripts

ID Sequence Length GC content
CUUUUCUCCAGGAAGAGAGCUGUGACCAGCAGCGUCCCUUAUUCGCUUG… 3304 nt 0.5820
Summary

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme is a retinoid target that triggers promyelocytic leukemia (PML)/retinoic acid receptor alpha (RARalpha) degradation and apoptosis in acute promyelocytic leukemia, where it is involved in the conjugation of the ubiquitin-like interferon-stimulated gene 15 protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human heart tissue from sudden unexplained death (SUD) cases identified the UBA7 as a differentially expressed gene, specifically upregulated in the "secondary condition" SUD subgroup compared to heart-healthy deceased controls [Neubauer et al. DOI:10.1007/S00414-025-03414-4].