Basic Information

Symbol
BMP2
RNA class
mRNA
Alias
Bone Morphogenetic Protein 2 BMP2A Bone Morphogenetic Protein 2A SSFSC1 BMP-2A SSFSC BMP-2 BDA2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Mechanical injury analysis

MANE select

Transcript ID
NM_001200.4
Sequence length
3545.0 nt
GC content
0.5207

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1241.40 kcal/mol
Thermodynamic ensemble
Free energy: -1301.65 kcal/mol
Frequency: 0.0000
Diversity: 1044.64
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.((.((....)).)).)).(((((((.....(((..((((((((((((((...(((((((.(((((((.((((((.(((((..........))))).))).)))((((((.((...((((.((((..((((......))))..(((..(((((((((((((.(((.(((((.((((.(((((..(((((((((.((((((((..........))))))))((((.(((((((((..((((((((.(((.(((.((((((((((((((((..((((((....).))))).)))))).)))))).))))((....))....(((((((((.(((((((...)))).........)))))).)))))).)))))))).)))))).)))).)))))..)))).((((..(((.(((......))).(((((((....)))))))..)))..))))...............))))).))))))))))).)).)))))...))).)......)).)))))))))).))))))).)))))).))))))......))))))))))))))....))))))).(((.(((((((.(((.((.(.((((((((.....((..(((((((......(((((((((((...(((((...((....)).)))))((((((......))))))))).)))))))).....((((((.(((((((...((((.....))))...))).))..)).))))))(((((((.((((((...)))))))))))))...((((((.((.(((....)))))))))))..........((((((((....((....(((((..(((...(((((........)))))...))).))))).....)).....))))))))........(((((........))))))))))))...)).....(((((...((...))...))))).........)))))))).)))))).))))))))))...((...((((((....))))))....)).......))))))).)))....(((.(.((((((((((((((((...((((((((.....))))..(.((.((((.(((((.(((((((((((((((((((((....(((((..(.(((((....))))).).(((((((.((((....))))..(((((((((((..(((.((..(((....(((((...((((((..((.(((((((((((....)))))(((((.(((((..((.......))))))).))))).))))))..))((((((........))))))...(((((((((((((((((.(.(((((((((((((((..((((.((..((.(((((((((.((.((((((((((((((.((.(((....)))..((((((((((....(((.....)))....))))))).))).....((((((((((((......))))........(((((((.........))))))).(((....(((((..((((((((((((((((((((((((((........(((........))).........)))))))))))))....................(((((.(((((((...((((.(((...)))..))))....((((.......(((...)))....((((((.......))))))...............((((((....))))))....((....))...)))))))))))))))).((((....))))...(((((((((((..((....((((....(((((.(.........).))))).(((((((...)))))))..))))....))..)))))))).)))....)))))))).(((..(..(((((.(((((.((...)).))))).((((((.((((......)))).))))))...)))))..)..))))))))..)))))....)))(((.(((((......))))).)))..((((((((((((..(((((...............((((..(((..(((.....(((....)))((.(((((((..((((((((.....)))).))))))))))).))....)))...)))..))))......(((((......(((((.....))))).....))))))))))))))))))))))...)))))))).(((((((..................))))))).)).))))...))))))...))..))...))...))))))))).)))))))).))))))...))).(((.(((((...(((((..(......)..))))).)))))..))).....)))))).).)))..))))))))).))))).)))))).)))))..............((((((((((....))))))))))..................................))).))))))))))).)))))...(((((((((........(((((.((((((((..((..........)).)))))))).)))))........(((......))).)))))))))...........((((.(((........)))...))))((((((((((......))))))))))..((((......))))((((((((..(((((((((.((((..((.....))..))))))))))))).((........))...((((((((((.((((......((((((.......((....)).......))))))......)))).....))))))))))...)))))))).)))))))))))).))))))))))))))..)))))))))))).)))).)).)))))..)))))))).(((..(((....))).)))..((((..(((((((.........(((((((((.(((((((.(((.(((..((..(((.........)))..))..))).))))))))))))))))))).(((((.....................)))))...)))))))..))))(((......))).((((...))))....)))))))).))))..........(((((((..(((((((....(((((......(((((((((((((....((((((((((.(((((((.....)))))))..)))))))..((((((...((((....)))))))))).((((((.(((((.((((((...(.(((....)))).))))))))))).))))))..........((((.(((.(((...((((((.....))))))))).))).))))......................(((((((.....((((....))))...))))))).....((((((..........))))))....))))))))).))))))).......)))))...((((....))))))))))))))))))..(((((((((((....))))))..............)))))......((((.....))))....))))))).
Thermodynamic Ensemble Prediction
(({({.{{.{{.{,.{{{({{(((({((((((({{{,{((({,((,{{||{|||}(((((((,(((((((.((((((,{{(((...,,{{...)))),.}||,}}},{|{((,((...((((,((({..{(((.,,,..|||}.((((,.{{{{{|||||{{{.{{({(({((,{,,{.{{||{,.{|||{{|||.((((((((..{....,..))))))))((((.(({((((((,,{({({(((,(...,{{||||||{||{|||||||,,,|)}|}}))}))))))).)))))),))}}}),)))))),,}})))),|{{{{(({{|.{{|{{|{|,,||||.|,.....,}}}}}}.}})))}||||||||}.||||||{{||,.{||||..,,,.,|||{.}|||}||{.....,|||.{{{{|||,..,||||}||,,|||.,||||,{{(({|.||,.,,||}|||||||}|||||,,{||{||,||.{{|,,..)}}..,),}))))))}})}.))))})),)}))),.))))))},..,.,))}))|}||||||,.,|||||||,.,((,(({{(((,({(.((.(.((((((((..,{,({..((({{{{||..,.(((((((((((...(((((...{{....}).)))))((((((......)))))))))}}))))))).,,,.((((((.(((((((...((((.....))))...))).))..)).))))))(((((((.((((((...)))))))))))))..{((((((.({.(((....)))))))))),,,}},,,,.,,|||||||,...,|,,,,{{(((,.(((.,.(((((........)))))...))).))))},,,,,||.....})))))))........|{||{,,,,..,,))))))))))}}...}).,..{(((((...,))))))..,)))),,)}}}....))))}}}}.)})))),)}}}}))))}.,.{,...((((((....))))))....,)}}.}}}},)))))),)))....(((.{.{(((((((({,,,,,,(((((.(((....,)},)))))|,{{.{(((.(((((.((((((({(((((((((((((,,{{{.,,...}||{|||||{((({({((((((({((.{(((.,|,|}}|,.({{{(((((((..,{{|||,,|||,...||{||,,.||((({..((.(((((((((((....)))))|{||{,(((((.,{{,......,}))))),))))).)))))).,))||{|||,.,,.,,,))})))...(((((((((((((((((.{.((((((({{((((((..((((.((..((.(((((((((.((.{{{{((((((({{{.{{,(({....)))..((((((((((....{{{...,,}}|.,,,|}}}})}.))}.....(((({{{{((((......))))..|,||..{{(((((....|,,..))})))}.{{{,,,.{{(((.{(,((((((((((((((((((((((((........(((........))).........)))))))))))}|,,......,,,.........(((((.(((((((...,,((.{({,,.|||.,}}||,,,.{{||....{{,({{...|}},...((((((.......)))))).,,............{(((((....))))))..,,{{....)}...,}}})))))))))))).((({....})))...(((((((((((..((....((({.,..(((((.{.........}.))))).(((((({...))))))).,))))....))..)))))))).)))..})))))))))}||,}},|||{{{{.(((((.{(...}}.))))).{(((((.((((......}))).))))))...))}}}.,}..}}}||||||||,,,}....)))||..|||,|......}))||||.{{.((((((((((((..(((((..............,((({..,,,..,.,.....(((....))){{.{((((((,.{{{,{{{{..,,,||}},|}|,}}}}}}).))},}})}}|||))|..}}|),,,.,,(((((......(((({....,,))),.....))))))))))))))))))))))}}}))))}}||.(((((((..................))))))).}},))))..}))))))...}}..})...))...))))))))).)))))))).)))))).,.,,,.{((.(((((...(((((..{......}..))))).)))))..)))....})))))).}.)))..))))))))).))))).}|||}}.}}))).....,,,,,,,,,((((((((((....)))))))))}.................................}}}|,}}|||}}}}}}.}})))...{((((((((,,,...,,{,||{.{||{{{|{,,({.......,..||.||||}}|,.,,|||,,,,},,.|||,..,,,,},.)))))))}}....,,,{,,,..,..{||,,,..{{{{|,{{{{|,.((((((((((......))))))))))..{(((.....,))}}.....,,..,(((((((((.((((..((.....))..))))))))))))).,..,}}}|,}))}}.,,,||,{{,.,,||||||||.,.{{,...},.}}}))))}})))),,.,|||||{{||||,..}}}}},}},}}}}}}}},,.}},}))))}}}}}}|,}}},,.)))))))))))))}..)))))))))))).)))}.)),|.,,|{{,,}}}}))}|{|..{((....))).)})..((((..(((((({.........((((((((,{(((((((.(((.(((..((..({{.........})}..))..))).))))))))))))))))))).{{{{{,,,.,,....,.,,,...,,|)))}}.,.}))))))..))))(((......))).((({...}))}....)))))))).})))..........((((((,.,(((((((....(((((......{((((((((((((....((((((((((.(((((((.....)))))))..)))))))..((((((...((((....)))))))))).((((((.((((,{((((((...(.(((....)))}.))))))))))).))))))...,,,,...,,,,.|||,|.{,..((((((.....)))))}|||,||..,..,,,|},,,........,,,....|||{{{{,,,,.,{{,..,,))),...||||,,,.}}},{{((((.......,..))))}}...,))))))))).))))))}.......)))))...((({....))))))))))))))))))..{(({{((((({....)))))}....,,,,,},...,}}}}......((({.....)))).....,.,))).

Transcripts

ID Sequence Length GC content
GCCGCCGCCGCCGUCGCCGCCGCCGGAGUCCUCGCCCCGCCGCGCUGCG… 3545 nt 0.5207
Summary

This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone and cartilage development. Duplication of a regulatory region downstream of this gene causes a form of brachydactyly characterized by a malformed index finger and second toe in human patients. [provided by RefSeq, Jul 2016]

Forensic Context

A study in human primary lung microvascular endothelial cells demonstrated that acute X-ray irradiation (10 Gy) induced a significant 11.7-fold upregulation of BMP2 mRNA at 24 hours post-exposure, as identified by RNA-seq analysis, with this gene being part of the upregulated endothelial-to-mesenchymal transition (EndMT) signaling pathway [Bouten et al. DOI:10.1038/s41598-021-03636-7]. A study in a porcine multiple trauma model with traumatic hemorrhage demonstrated that bone marrow-localized concentrations of the BMP2 were significantly lower in the fracture zone of injured animals compared to sham controls [Bläsius et al. DOI:10.1186/s40001-023-00996-w].