| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCAUUUAUACACGCUUUGUCUGCAGGGAAGUUCUCCUGGUAAUUACA… | 1707 nt | 0.6157 |
Predicted to enable ubiquitin binding activity. Predicted to be involved in ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway. Predicted to be part of ESCRT I complex. [provided by Alliance of Genome Resources, Jul 2025]
A study in human patients identified the UBAP1L as the most down-regulated mRNA in myocardial fibrosis after acute myocardial infarction [Wang et al. DOI:10.2147/IJGM.S329391], and a separate study found it was upregulated in heart failure compared to myocardial fibrosis [Wang et al. DOI:10.3389/fcvm.2021.664044].