| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCUCUGGUUUCUGGCCCCUUGUCUGCAGAGAUGGCUCCCAAUGCUUCC… | 894 nt | 0.4374 |
This gene encodes a protein which contains two ubiquitin-like domains and appears to have similar function to ubiquitin. Through covalent attachment, the encoded protein targets other proteins for 26S proteasome degradation. This protein has been implicated to function in many cellular processes, including caspase-dependent apoptosis, formation of aggresomes, mitotic regulation, and dendritic cell maturation. Upregulation of this gene may promote inflammation in chronic kidney disease and has been observed in many cancer types. [provided by RefSeq, Aug 2017]
No relevant information is available at the moment.