| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACUGACCGCGGGGCAGCUGCGGAGCAUGUCGACCCCGGCCCGGAGGA… | 2241 nt | 0.3637 |
The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Its protein sequence is 100% identical to the mouse, rat, and rabbit homologs, which indicates that this enzyme is highly conserved in eukaryotic evolution. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulated the UBE2B in microglia, as part of a broad disruption of the ubiquitin-mediated proteolysis pathway [Oladapo et al. DOI:10.3390/Ijms26020649].