Basic Information

Symbol
UBE2D2
RNA class
mRNA
Alias
Ubiquitin Conjugating Enzyme E2 D2 UBC4 UbcH5B Ubiquitin-Conjugating Enzyme E2D 2 (Homologous To Yeast UBC4/5) (E3-Independent) E2 Ubiquitin-Conjugating Enzyme D2 P53-Regulated Ubiquitin-Conjugating Enzyme 1 Ubiquitin-Conjugating Enzyme E2-17 KDa 2 Ubiquitin-Conjugating Enzyme E2 D2 E2 Ubiquitin-Conjugating Enzyme D2 Ubiquitin Carrier Protein D2 Ubiquitin-Protein Ligase D2 PUBC1 UBCH4 Ubiquitin-Conjugating Enzyme E2D 2 (UBC4/5 Homolog, Yeast) Ubiquitin-Conjugating Enzyme E2(17)KB 2 Ubiquitin-Conjugating Enzyme E2D 2 Ubiquitin Conjugating Enzyme E2D 2 EC 2.3.2.23 EC 2.3.2.24 EC 6.3.2.19 E2(17)KB2 UBC4/5 UBCH5B UBC5B
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_003339.3
Sequence length
2530.0 nt
GC content
0.4443

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-741.7 kcal/mol
Thermodynamic ensemble
Free energy: -792.11 kcal/mol
Frequency: 0.0000
Diversity: 647.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((.(((((((((((.(((..((((((.(((.(((((((((....)).(((((..(((((.............))))).))))).((.(((.(((((...(.(((((((...))))))).).....))))))))))))))))).))))))))....)..))).))))))...))))).((..(((((.(....(((((((((.((((.(((((..((((.(((((.(((....(((((((((....((((((.((((........(((((((....((((..(((((((..(((((..............))))).))))))).........)))).......)))))))))))..))))))..))))))))).((((....))))..))).)))))))))..))))).))))(((((...))))))))))))))..).)))))...)).(((.(((....)))..)))...(((((...((.((((...((((((((....((((...)))).....))))))))...)))).))..)))))((((........))))..)))))))....((((((((((((.((((((((((..(((((((...........(((((...((........)).((((......))))............((((..(((((..(((((.((..((....))..)).)))))...)))))))))..(((((...)))))((((((((..(((((.......(((((.((.((.(((((((.....(((((.(((((((((((((...............))).)))))...))))))))))))))))).)).)).)))))...((((.(((....(((((((.((((((((((.(((((.............))))).))).(((((((.......).))))))..((((...))))......)))))))..)))))))....)))))))....(((((((((((.((((.((((.(((...((((..((((.(((((.(((((....((((((.((....))..)))))).............))))).))))).)).(.((((......)))).).(((((.((((.(((......))).)))).)))))...(((((((((((...........))))))..))))).....))..)))))))))).).))))))))).)))))))))))..)))).)))))))))))))))).)))))))...)))))))).))))...(((((((((...)))))))))......(((((((.((((((.((((.((((((...((((((((((.(((.(((((........(((((.(((..(((..((((..(((.........(((((.(((((((..(((.................)))...)))))))))))).......((((.((.(((((((....(((.(((((....))))).)))..))).)))).)).)))).............)))..))))..))).....))))))))..........((((((.(........).))))))......(((((.....)))))....(((((((.....(((((((((((((((.((((.((((....)))).)))).)(((....)))((((((((((.((((((((.((((((.......((((.......((((((.((((...((((....(((((....((((((((..((((.......)))).))))))))(((((((((..((.((((((((((.......))))))))))))..)).)))))))((((.(((...))).))))...((((((((..(((......))).)))))))).)))))))))))))))))))....))))......))))))..)))))))).))))))))))...))))))))))))))..)))))))......)))))...))).))))))).))).(((((((((((((.......))))..(((((..((((.............))))...))))).......((((((..((......))..))).)))........(((((((((...(((........)))...))))))))).((((..((....))..))))......(((....))).((((((((......))))))))((((((.(((((((.....((((((........))))))........((((((...))))))....)))))))))))))...(((.......)))((((((...((((.(..(((..((.(((((((....))))))).)).....)))..)))))..)))))))))))).)))))))))...)))))))))).))))))).....(((....)))((((((((((((((......)))))))..))..)))))...((((............))))(((((((...(((.......)))...)))))))))).....
Thermodynamic Ensemble Prediction
(((((({.{{(((((((((.{((,.,((({(((((.((((((({(.,..}}.(((((..(((((.............))))).))))),((.((,,(((((,,.({(((((((...)))))))})}...,)))))))))}))))))).))))))))....)}.})),})))))..,}|})}.((..(((((.{....(((((((((,((((.(((((..((((.(((((.(({...,(((((((((,,{.((((((,((({..,,,,..(((((((...,((((.,(((((((..(((((.........,....))))).))))))}...,,....},,}..,,...)))))))}}}}..))))))..))))))}}}.(({{.,,,,)))..))).)))))))))..))))).))))(((((...))))))))))))))..,.)))))}}.}}.{({,(({....))}..}}}...(((((...((.((((...((((((((..,.((((...}))}..}..))))))))...)))).)}..))))){{{{........}}}}..}))))))....(({(((((((((.,(((((((((.,(((((((..{.,{{{{..,(((({{..({{{{{{{{{{{.,,({{{{...((((......}}}}..{{.....,,({{(((((.(({,(({{{{.|{.{{{.||||{{{||||,,,,,..,|||,.,,||}|}{{,{{|||,.,((((,,.....(((((.((.((.(((((((.....(((((.(((((((((((((...............))).)))))...))))))))))))))))).)).)).)))))...,|||,||{..,,{((((({.{(((((((((.((({(,,,{{.....|||)))}|,}}}.((((((,.......}.))))))..((((...})))...,,,)}}})))..))))))),...))))))},{{{((,,,,|||||}|.{||{||({((((({(((....{((...,,|}}}||,.}}}||||||}||....|},.}}},}}.....,.......||||},}})}},...|,||{|,.,,,,|,,}.|.(((((.((((.(((......))).)))).))))).,}}}))|}|}})}}.}}}.}}).,},))))})..}))})))))))}..,,,}.)))))))))))))))))),,)).))),,.},,,.))))),),,))))))),)))))))}}.,,,))))).))))...{((((((((...))))))))}......(((((((.((((((.((((.((((((.,,{,(((({((({({..,,,,,........(((((.(((,.(((..(((({{(,(...,{....(((((.(((((((..,,{.....,,,........,)),...))))))))))))....,..{{{{.(({(((((((....(((.(((((....))))).)))..))))),)).)),,}},.............,))},})))..))).....))))))))...,,{{,,.(((.......}}}.,(((((((((((((..(((((.....)))))....(((((((.....(((((((((((((((.((((.((((....)))).)))).){({....})}{(((((((((.((((((((.((((({.......,,,..(((((...))))){{{....{{||.,,,{{{.....,((((((((..{{{{,,,,,.,)))).)))}||||,{{{{{|||,,|,{((((((((((.......)))))))))))}..}}.}}}}}||({((,((,...,,}.))))),||{{{{(({,|{,,...,,{||..}}}|||||.,,...})}}}},,,,))))},,,,,,},.....))))))..)))))))).)))))))))}...))))))))))))))..)))))))........)))))..))))))))}..,{(((((..,{({,{{{......,}}}}..|,{,,{((((({.{{.{(({{{.......,..))))}}.....(((((({.((......)).}))).)))..,.....(((((((((.,.(((........)))...))))))))).,}||.....,,,.))))))}...,...,,..))))))|(((((((......)))))))}||||||.,.,,,,......{{((((........)))))},,||,...((((({...}))))).,,||}})))}}}}}}},,,{|{....,,,}}},{{|||...||||}|.,||,..{{.(((((({....))))))).)),...,}},,,}}}))}}}}})))}}))}}.,..})))))...)))))))))).))))))).....,{{....|||(({{(({{((((((......)))))))..))},,}}}}...((((............))))(((((((...(((.......)))...)))))))))).....

Transcripts

ID Sequence Length GC content
GGCCCCACCCCGGCGGCGCAGCCCGCCCGCCCGCGCGUCCCUCGGUCCA… 2530 nt 0.4443
GGCCCCACCCCGGCGGCGCAGCCCGCCCGCCCGCGCGUCCCUCGGUCCA… 2694 nt 0.4477
Summary

Regulated degradation of misfolded, damaged or short-lived proteins in eukaryotes occurs via the ubiquitin (Ub)-proteasome system (UPS). An integral part of the UPS system is the ubiquitination of target proteins and covalent linkage of Ub-containing proteins to form polymeric chains, marking them as targets for 26S proteasome-mediated degradation. Ubiquitination of proteins is mediated by a cascade of enzymes which includes E1 (ubiquitin activating), E2 (ubiquitin conjugating), and E3 (ubiquitin ligases) enzymes. This gene encodes a member of the E2 enzyme family. Substrates of this enzyme include the tumor suppressor protein p53 and peroxisomal biogenesis factor 5 (PEX5). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]

Forensic Context

A study in human body fluids demonstrated that the UBE2D2 was used as a housekeeping gene, where its presence indicates recovery of suitable RNA for analysis [Danaher et al. DOI:10.1016/j.fsigen.2014.09.005]. Another study in humans using RNA sequencing on degraded forensic samples detected the UBE2D2 at varying levels in most samples, except for extensively degraded samples or those with low read alignment percentages, validating its utility as a control gene in transcriptomic analysis [Lin et al. DOI:10.1016/j.fsigen.2015.03.005]. A study in human body fluids demonstrated that primers targeting transcript stable regions (StaRs) for the UBE2D2 provided improved and more consistent detection in degraded circulatory and menstrual blood samples compared to conventional primers [Lin et al. DOI:10.1016/j.fsigen.2015.09.012].