| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCCCCACCCCGGCGGCGCAGCCCGCCCGCCCGCGCGUCCCUCGGUCCA… | 2530 nt | 0.4443 | |
| GGCCCCACCCCGGCGGCGCAGCCCGCCCGCCCGCGCGUCCCUCGGUCCA… | 2694 nt | 0.4477 |
Regulated degradation of misfolded, damaged or short-lived proteins in eukaryotes occurs via the ubiquitin (Ub)-proteasome system (UPS). An integral part of the UPS system is the ubiquitination of target proteins and covalent linkage of Ub-containing proteins to form polymeric chains, marking them as targets for 26S proteasome-mediated degradation. Ubiquitination of proteins is mediated by a cascade of enzymes which includes E1 (ubiquitin activating), E2 (ubiquitin conjugating), and E3 (ubiquitin ligases) enzymes. This gene encodes a member of the E2 enzyme family. Substrates of this enzyme include the tumor suppressor protein p53 and peroxisomal biogenesis factor 5 (PEX5). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
A study in human body fluids demonstrated that the UBE2D2 was used as a housekeeping gene, where its presence indicates recovery of suitable RNA for analysis [Danaher et al. DOI:10.1016/j.fsigen.2014.09.005]. Another study in humans using RNA sequencing on degraded forensic samples detected the UBE2D2 at varying levels in most samples, except for extensively degraded samples or those with low read alignment percentages, validating its utility as a control gene in transcriptomic analysis [Lin et al. DOI:10.1016/j.fsigen.2015.03.005]. A study in human body fluids demonstrated that primers targeting transcript stable regions (StaRs) for the UBE2D2 provided improved and more consistent detection in degraded circulatory and menstrual blood samples compared to conventional primers [Lin et al. DOI:10.1016/j.fsigen.2015.09.012].