| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGGCUCCCGGCGUGCAGCUUGGUGGCGGCUGAGCCGGCAGCGGGCCGC… | 3982 nt | 0.4789 |
Enables ubiquitin conjugating enzyme activity. Involved in protein polyubiquitination. Acts upstream of or within protein ubiquitination. Predicted to be active in nucleus. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the UBE2D4 as one of six key cuproptosis-related diagnostic biomarkers for sepsis, where it demonstrated the highest AUC (0.911) among the signature and its expression was validated in a separate cohort, with single-cell RNA-seq showing its major distribution in monocytes, T cells, B cells, and NK cells in sepsis samples [Wang et al. DOI:10.1016/j.heliyon.2024.e27379]. In a separate human study on weight loss, the UBE2D4 was found to be downregulated in subcutaneous adipose tissue during short-term weight loss in obese participants [Bollepalli et al. DOI:10.1038/ijo.2017.245].