| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUCAGCGCGCCUGCGCCGAGCGGCCCUGCGCGCAGUGAGGCAGUGG… | 4167 nt | 0.4226 |
The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family and catalyzes the covalent attachment of ubiquitin to other proteins. The protein may be involved in degradation of muscle-specific proteins. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic alcohol exposure significantly upregulated the UBE2G1 in hippocampal tissue, as identified through high-throughput sequencing and bioinformatic network analysis [Du et al. DOI:10.3389/Fphar.2024.1377501]. Separately, single-cell RNA sequencing in methamphetamine-administered mice showed the UBE2G1 was significantly dysregulated in cortical microglia, associated with ubiquitin-mediated proteolysis and protein processing in the endoplasmic reticulum pathways [Oladapo et al. DOI:10.3390/Ijms26020649].