Basic Information

Symbol
UBE2G1
RNA class
mRNA
Alias
Ubiquitin Conjugating Enzyme E2 G1 UBC7 UBE2G Ubiquitin-Conjugating Enzyme E2G 1 (Homologous To C. Elegans UBC7) Ubiquitin-Conjugating Enzyme E2G 1 (UBC7 Homolog, C. Elegans) Ubiquitin-Conjugating Enzyme E2G 1 (UBC7 Homolog, Yeast) Ubiquitin-Conjugating Enzyme E2 G1 E2 Ubiquitin-Conjugating Enzyme G1 Ubiquitin Carrier Protein G1 Ubiquitin-Protein Ligase G1 E217K Ubiquitin-Conjugating Enzyme E2G 1 Ubiquitin Conjugating Enzyme E2G 1 EC 2.3.2.23 EC 6.3.2.19
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_003342.5
Sequence length
4167.0 nt
GC content
0.4226

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1205.60 kcal/mol
Thermodynamic ensemble
Free energy: -1289.17 kcal/mol
Frequency: 0.0000
Diversity: 1042.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((((..(.(((....))))..))))))..))))))(((...((((((((((((.((((((((....((((((((....(((..((((((((((.((..(((....(((...((((.((.(((((((((.(((........(((.((.(((.(((((......(((((((.(((((....))))).((((..((((((((.((....)).)))))).))))))......))))))))))))))))).))).)))))))))))))).)))).)))...)))...)))))))...((((((...(((.(((....((..((((.(((....))).))))))..))).)))((((.(.((((((((((((.(((..((((((((((....((((((((((((((((........(((((((((((((((((....(((.....((((.......))))..)))...)))))).)))).)))))))......(((((((((((...))))).))))))....((((((((((.(....((((((((((((((((.((((((((....(((((...))))).(((....)))....(((..((((((........(((.((((((((..((((((((((.((((...((..((((((.((.(.((((.(((.((((((.......)))))).....(((((...)))))...(((((..((((((((..(((((((...((....))...)))))))...))..))))))..))))).((((..(((.((.(((((((((((((.((((((......(((..(((((((..(((((..((......((((((((....)))))).))........))..)))))..)))))))..))).........)))))).)).............))))))))))).)).)))..(((.(....).)))...(((((.....(((((((((......((((..((((((..((........))..))))))...............)))).......))))))))))))))......)))).......))))))).)))))))))..)))))).))))))).....)))..)))))))).))).((((((..((((((.....))).))).)))))).......((..(((.(((((((.......(((((((......(((((((..((((((((((.....((((((((...((((((........)))..................(((((((.((...))))))))).(((((((......((((..((((((((((((((...((((((...((((((....))))))....))))))...............))))))))).)))))..)))))))))))...........)))...)))))))).((((((...(((((........((((((......)))))).........)))))...........((((.((((((((((...)))))))))).))))((((.(((((....((((.......)))).(((.....)))...))))).))))...........(((((((.((((...((((((.((((..........(((((((((........))))))))).((((......)))).................((((..((((...........)))))))))))).))))))(((((.((...(((((.((........)).))))).)).)))))....(((((((......))))))).......(((...((((((((((((((((((((((.....(((((...(((......)))..))))).......................(((((((.(((........)))))))))).(((((((((.....((((........))))....)))))))))............((((((..(((((....)))))..))))))......))))))).......)))))).....)))))).)))...))).....(((((((((....((((....))))....)))..))))))...))))))))))))))))))))))).)))).))))))).(((((((......))))))))))))))))))))))))..))...((((((((((((.........))))).....)))))))......(((((((..(((((((((...)))).)))))))))))).....((((....))))....))))))..)))...((((((((((..........((((..((((...))))))))))))))))))..))))))).).).))))..)))))))).(((((.((((((((.........((((.((((((.((..(((((..(((.((((.......)))).)))..)))))..))))))))))))(((((((((......((((((((((..((((......))))))))).))))))))))))))(((((...)))))))))))))..)))))..........)))..))))))).))))..(((((((((.((((...(((((((((((((........(((((((.(((.........((((.......))))........)))))).)))).........((((((((((((((((((..((......((((((.((((((((...))))......)))).)))))).....))..))))))..((((((....))))))..........)))).))..))))))....)))))))))))))...))))))))))))).....((((((......)))))).)))))...)))))).....)))))...)))))))))).........))).)))))))))))).).))))))))))..(((.((((.((((.((((....))))))))..)))).))).((.(.((((.(((((((((((((.............((((....)))).((((....))))((((((((..((((((....((((((((..((((..((((((....((((((((((..(((.((.(((.((((((..(((.((((.((...(((..(((..((..(...)..))...)))..)))...)))))))))....))))))...)))))))).....))))))))))...))))))......)))).............))))))))))))))..))))))))((.(((((((....)))).))).))))))))))))).))))))).))....))))))))))))))))(.((((((...)))))).)...(((((..((((((((..(((.((((............)))).)))))))))))((((..(((((((.(((((((..((((....(((((((......)))))))..........))))))))))))))))))..)))).)))))..)))))))).)))))((((...(.((((((((......)).)))))).)...))))...)))))))...)))...(((...(((((.(((((.(((((((((((..((((((((((((((((..(((((.....................(((((((.((((((..((((....)))))))))).))))))).(((((....(((((((.....((((((......((........)).....))))))(((((((..(((....))))))))))...(((((.(((((((((..((((.(((((.(((((((((((.(((((..((((((.........))))))))))).....)))))..))))))........((((.....((((.....))))...(((((....)))))......)))))))))..))))))))))))).))))).........))))))).....))))).((((...(((((...))))).))))...)))))....)))))))))))))))).))).........))))).)))...))))))))))(((((......)))))((((.(((((.....)))))))))((((...((((.....))))....)))))))....
Thermodynamic Ensemble Prediction
{(((((.((((({,.({{{,..}}))},..))))|(((.(((((((.((((((((((((((({((.(((((.({,((((((({....((.,((..(((((,(.(({........||,}},((((.((.(((((((((.(((.,{{{..,{|||{({(((((((({,.....,,{{{,,.||{||},,,))))),((((.,((((((((.{(....}),)))))).|||}||{{.....,))))).}))))}))))}.}.)))))))))))))).)))).},},})))))}..))}))))}..,))))}))},,.))))}})))..((((.(((....))).))))....(((({{{(((((.((,((((((((((.(((..((((((((((....(((((((((({,((((..........((((((((((({.(((((.(((.....((((((((.(((((......{{(((({{{.,,........|{{{.,..{((((((((({...}))))}}))))|.,,.||||{{{{{{{{{{|||||...{,,,.{,..,.,.{...,,....(((((...})))).,{{...,}}|({,,.,,..{{{{,{,...{((({.{{{{....)))).))}}}..,,}}}})}.)))))}}),)))|.||||||.,,...((((((.......)))))).....(((((...))))).,))))}..))))).))))))}},}},))).))))).((....)).,..{{{..{,(((((.((((((((((((..((..((((((((((((((..((((((.,{,,{(((..(((((((..(((((..((,,{,..((((((((....)))))).))....})}.)}..)))))..)))))))..))).,},.,},.)))))){((((..(((.(((((.((((((...(((({((,,.(((((..(((((,(((({.{{,...},)))))})))).....)).)))...,))).))))..)))))))))))))).))))}((((,(((((((...((((..(((({..,{{((,(,.,{{,,|||||,,{{((({..{{{{..{,....,,.}})}|,,|}}}}}}|}}.,|.}||}|,,.,{{{{.((((((..((((((.....))).))).))))))......,,,..,,,,..,})},.......,||{.{(((,{,...,,,}||||||{{|,{{{{....((((((((...((((((........}},......,{........}}{{{{{{{{((...))))))))).{(({({{...,{{((((..((((((((((((((...((((((...((((((....))))))....))))))...............))))))))).)))))..))))))))))}..........})))...))))))))......,|,,{((((.....,,,((((((......)))))).,.......))))}.})}}.})}}}}}||.((((((((((...)))))))))).,,,}||||.|||{{....{{{{.,,,.,,|||}.({{,,...,))..,))}},.}))),,........}))))..))))..))))))).,,.||||.........(((((((((........))))))))).,{{,....,,))},.................,,...))))..))))))))))))..))))..)))))))).))))).,,..}}}(((.......)))..)))))))))))).......,|||||||,,....}}}}}}},.....,{{{,,.{({{({{(,(((({((((,,,({{{{{((((({{{,,,......|||.,|||||..,,|,,.,......},....,}||{{{{|,,{|,,......}})))}|||}.(((((((((.....((((........))))....)))))))))..,,,.......(((((({{,,,,|}}}})))||{{|||||,.....))))))))}......},,))).}.,}))))))})},..})))....((((((((.((((((((((,,..,({,,((({{{,,,.}|}},.}}}..,{((((..(((.....)))...)))),.....(((((((......)))))))((((((((((....))}}}))))))((((,,,(((,,,,...{{{||,||{....,,|||,..,{{..(((((((..,((((((((...)))),))}},)))))))....})}...}},..((((((((({({,........{{(((((((...,|||||.((((..,,||},.)))}}}},))))))))))}))))))))))))))))),))}}))..)))).})))))))))..))))))))((((.((((((.((,.(((((..(((.((((.......)))).)))..))))),.))))))))))))(((((((((......((((((((((..((((......)))))))))))})))))))))))){{{{,...|}}||,{{{{{,..,|||,,|,,.......,)}))))))}})}},....(((((((((.((((...(((((((((((((........{{{|{((.(((.........((((.......))}}........}}}}}},}}}}.....,,,.((((((,(((,{((((((..((......((((((.(((({{(,...,}}}......)))).)))))).....))..))))))..((((((....))))))..........}}},,)),.))))))....)))))))))))))...)))))))))))))....,{{(({{,.....)))))}{|||||...,,,),,)}}}})))))...)))))))))).........))).))))))))))|{{(({...))).)),.)).))))))))))){(((....)))}(({{..,,,.}))).{(,(.((({{(((((((((((((..{{(........{{(({{{{{{{..((({...,))})}}}}}}||..|||{({,{{(((,{,(((((((({{((((((({...((((,,(((...|}}..}}}},.||||||}}}...((((.((...{((,,(((,.{{..,...,..,}...)}),,))),,.)))))).....{{|,|,.,...)))}.)))}}}},,,))))),..,,,},(((((({...|.(((((((({,,.{(((((.....))))))..},,,,))))))))),,,..)))))))..))}..))))))))))).))))))}.}),,.))))))))).))))))))){(((((...}})})){{|..{(({...{(((((((..(((.((((,........,..)))).)))))))))))}}||,,(((((({{(((((((..{(((....(((((((......)))))))..........}}}}))))))))))))))....(((((........))))).,|(((((((....))))))),...)))).)))),,,,((((({....})))))..,...,...,|||..,.((((,{(((((.(((((((((((..((((((((((((((((..(({{(.......,....,,..|||,,(((((((.((((({.,((((....)))))))))).))))))).(((((..,,(((((((.....((((((......({........)).,...))))))(((((((..(((....))))))))))...(((((.(((((((((..((((.(((((.(((((((((((,(((((..((((((.........))))))))))}...,.}))))..))))))........{{((.....,,,|}...,||||...(((((....)))))...))))),,)))))..))))))))))))).))))).........)))))},,,,},))))).{{{{|,.|{{{|.,,,}})}..,}},,,)))}}....)))))))))))))))).))).........))))).)))...)))))))))),||{,.,..{{(({.(((({{(((({.....)))))))))).}))}}{(({.....}}})......))))))...

Transcripts

ID Sequence Length GC content
AGUCUCAGCGCGCCUGCGCCGAGCGGCCCUGCGCGCAGUGAGGCAGUGG… 4167 nt 0.4226
Summary

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family and catalyzes the covalent attachment of ubiquitin to other proteins. The protein may be involved in degradation of muscle-specific proteins. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic alcohol exposure significantly upregulated the UBE2G1 in hippocampal tissue, as identified through high-throughput sequencing and bioinformatic network analysis [Du et al. DOI:10.3389/Fphar.2024.1377501]. Separately, single-cell RNA sequencing in methamphetamine-administered mice showed the UBE2G1 was significantly dysregulated in cortical microglia, associated with ubiquitin-mediated proteolysis and protein processing in the endoplasmic reticulum pathways [Oladapo et al. DOI:10.3390/Ijms26020649].