| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCCCGCCCGCAGUCCAGGCUGGACUGGGCGGCAUUUGCCGAGGCUCCU… | 4164 nt | 0.3886 |
The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum (ER) and may contribute to quality control ER-associated degradation by the ubiquitin-proteasome system. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulates the UBE2J1 in cortical microglia, where it is involved in the ubiquitin-mediated proteolysis and protein processing of endoplasmic reticulum pathways [Oladapo et al. DOI:10.3390/Ijms26020649].