| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGUCCGAGGCGCUGGGCCAGGCCGGAGCCGGACUACGGGAGCCGAGGC… | 1159 nt | 0.6324 |
The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is linked with a ubiquitin-like protein, NEDD8, which can be conjugated to cellular proteins, such as Cdc53/culin. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulates the UBE2M in cortical microglia, as part of a broad disruption of ubiquitin-mediated proteolysis pathways [Oladapo et al. DOI:10.3390/Ijms26020649].