| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGAAGUGCGGACCGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGA… | 3239 nt | 0.5054 |
The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s), and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is 98% identical to the mouse counterpart. [provided by RefSeq, Jul 2008]
A study in humans using RNA-Seq data from dried blood stains and whole blood identified the UBE2Q1 as a candidate mRNA marker for age estimation, noting its expression direction was conflicting between the RNAgE and U.S. data sets [Dørum et al. DOI:10.1016/j.fsigen.2023.102976].