Basic Information

Symbol
BMP6
RNA class
mRNA
Alias
Bone Morphogenetic Protein 6 VGR1 VGR Vegetal Related Growth Factor (TGFB-Related) VG-1-Related Protein VG-1-R BMP-6 VGR-1 IO
Location (GRCh38)
Forensic tag(s)
Wound age identification Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001718.6
Sequence length
3784.0 nt
GC content
0.5566

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1483.90 kcal/mol
Thermodynamic ensemble
Free energy: -1550.62 kcal/mol
Frequency: 0.0000
Diversity: 836.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((((((((.((((((.(((.(((((((((((((.((((((((.(((......(((((.(((((.(.(((((((((..(((((((..(((((.(((((((((((.(((((((((.((((..(((((.((...)).)))))))))))..)))))))(((((((.((((((((.((((((....))))).).)))).)))).))))))).))))))(((((((((((((((((((((.((((.....)))).)))))....(((........))).((.(.......).)).))))))).))))..)))))((((....(((((..((...((((....))))...)))))))))))....)))))))))))))))))..((.(((((...))))).)).))))).((((((((((((((((.((((((((((((.(((((............)))...)).)))))))))).....(((((((((((.(((....(..((((((((((..(.(((....))).)..))))).((((((...)))))).))..)))..)...))).).)))).))))))(((((.(.((.(((.....))))).))))))((((((((((.(((((.....((((((..((((((........))))))..(((((....(((.(..((((((...))))))..).)))..)))))..)))))))))))..)))))))))).(((....))).....)).))))))).))))))))).....)))).).))))).))))).))).)))...))))).)))))).((((((((...))))))))...((((((..((((((...((((((.(((((((((...(((....(((((((.((((.(((.((((((((((((((((((((((.(((....)))(((((.((.(((((..((.((((((((((...))))(((((((((((((..(((((((....((((((((((((((...((((.((....))..)))).(((((((..(((((...(((((((((.((.(((........))).))....)))))))..))...)))))..).)).)))))))))))))))))).....)))))))..)))).((((........))))...)))))))))....)))))).))))).)).)).))))).)))))))))))(((.....)))((((((((.(((((.(........)))))).......(((.......)))..(((((((((((..((.......)).))))))))))).))))))))....))))))))))).)))))).)..))))))))))))))))))).)))))).))))))))))))))))))).)))((((........))))..(((((...)))))....))))))(((((.((((.(((((((((((((((.((((........))))...)).))).....))))))((((((...(((((((((((..((..(((.(((........))).))).))..))))....)).))))))))))).((((((((((....))).))))))))))).)))))))))((((((((.(((.((((.....))))..))).))))))))(((((((.(((((((......(((((...((((((((((((.((((.(((((((((((((........)))))))).((....))((.((((((((((((((.......((((((((((..(((.(((((((..(((((((..(((((..((((((....))))))...))).)).)))..)).))..))))))).)))(((.((((.......)))).)))......((.((((((((((((....(((((((((((.(((((.((((((....)).))))..)))....))..)))))).)).)))..)).)))))))))).)).))))))))))((((((((.((((.((....))))))((((.((.(((.....))).))))))(((((((((...((..((((((((((((((.((((..(((((((((.....))).).))))).(((((...((((.(.((((......)))).)))))...)))))..(((((((((((((((.......((.((.((((....)))).)).))......(((........)))..(((((((.((.....((((((((..((((((.....))))))........(((((...(((..(((((((.((......((.....))((((..(((.....)))..))))((((((...((((..(((((........)))))))))))))))..(((...((((...))))...))).....(((((((((((((..((..........))..)))))))....))))))..............))..)))))))....))))))))((((((.((((((((((.(((..((...(((......))).))))))).))))))))...))))))(((((((.((((((.(........).)))))))))))))))))))))....)))).).))))......))))))))...((((.......)))).......(((((..((..(((((.(((.(.(((((...((((((.(((((........(((((........)))))))))))).))))...........((((......))))..((((((.......))))))((((........)))).((((.(((..(((((((...)))))))..)))...)))).......))))).).)))))))).)).((((.............)))).((((...))))....(((((.(((....))).))))).)))))...)))))))..))))))))))))))))))..)).)))))))))..))))))))(((......)))........................(((.(((((((....((..(((((((((((.......)))))....))))))..))......))))))))))((((((((((((((...((((......((((((((((.((((((((((((...(((((...((((.......((((...........))))...))))(((...((((((((.........(((((((..(((((.........................))))).)))))))................))))))))..))).........)))))..)))))).)))))))))).)))))).))))....))))...))))))))))....)))))))..........(((((((....)))))))(((((((((.(((....)))...)))))))))....))))))).)).(((((..(((.....))))))))......((((((((((....(((((((..((((((......(((((..((.....))..)))))((((((((.((..........)).))))..))))(((((.....))))).))))))..))))))).....))))))))))......(((((.(((...((...(((((.....))))).))))).))))).))))).))).).))))..)))))..))).....)))))......))))))).)))))))........(((....))).....))).))))).....(((((.....))))).))).
Thermodynamic Ensemble Prediction
.....(((((((((((.(((((({((,.(((((((((((((.((((((((.,(({...{{(((((.(((((.(.(((((((((..(((((((..(((((((((((((((((.(((((((((.((((..(((((.({...)).)))))))))))..)))))))(((((((.((((((((.((((((....))))).).)))).)))).))))))).))))))(((((((((((((((((((((.((((.....)))).))))),.{.,({........}))}{(,{......}},}).))))))).))))..)))))(((({...{(((({{{{...((({....}}},..}),)))))))))....)))))))))))))))))..((.(((((...))))).)).))))).((((((((((((((((.({((((((((((.(((((.{,........,))).,.,).)))))))))).....((((((((({{.(((,,{,(,(({.,,(((((..(.(((....))).}..))))).((((((...)))))),|,..,,...}}},)))})))))).))))))(((((.(.((.(((.....))))).))))))((((((((((.(((((.....((((((..((((((........)))))).,(((({....(((.{..((((((...))))))..}.))).}))))}..)))))))))))..)))))))))).|{{....))),....)).))))))).))))))))).....)))).).))))).)))).,)))..)))))))))).)))))){((((((((...))))))))}}.((((((..((((((...((((((.(((((((((,..{((....(((((((.,(((.(((.((((((((((((((((((((((.(((....)))(((((.((.(((((,.((.((((((({((...}})}{((((((((((((..(((((((..{(((((((((((((((.(.((((.((....))..))))}(((((((..(((((,..(({((((((.((.(((........))).))....))))))}..)).,.)))))..)}}).)))))))))))))))))).,,}.)))))))..)))).((((........))))...)))))))))...,)))))).))))).)).)).))))).)))))))))))(((.....)))((((((((.(((((.(......,.))))))..,,.......|,.........(((((((((((..((.......}).))))))))))).))))))))....))))))))))).)))))).,..))))))))))))))))))).)))))).))))))))))))))))))).)))((((........))))..(((((...)))))....))))))(((((.((((.((((((((((({(((,,,,,..}}}}..|||,,...,.,)})},..))))))((((((,..(((((((((((..((..(((.(((.,....,.))).))).))..))))}...}).))))))))))).((((((((((....))).))))))))))).)))))))))((((((((.(((.((((.....))))..))).)))))))){((((((.{((({{({{....(((((...{{{{((((,((((((((,((((,,{{{{,,,.}}},..})))))))).||}}.((((({,..|}||||((,(({{.{..{({((((((((........}}.)))))}|}.,}..}}||,}}((((((....))))))...{||{|,{{({{{{{{{..{|(((((,.{,.(((.((((.......)))),))}.|.|}}||.((((((((((((.,..(((((((((((.{{((({,(((,,....))},)))}.},|....,},.)))))).)).))).,)).)))))))))),||{|||.(((.((((({,{...((((.((....)))))).....(((....)))})))))).)))(((((((((...,,..((((((((((((({,((((..(((((((((.....))).).))))).{((((...(((,,(.((((......)))).)))))...))))}..((((((({{((((((.......{(,({.((((....)))).}}.}},,....{{{.....,..}||,.(((({({.((..,{{((((((((..((((((.....))))))........(((((,..,((,.(((((((.((......({.....))((((..(((.....)))..)))}((({{,...{{||..(((((........)))))}}}}})}}}}..(((...((((...))))...)))..,..(((((((((((((..{{,.........))..)))))))....))))))..............))..))))))).}}.}},)))))((((((.((((((({,,.((({.{(...({{......}}}.}}}}}}),))))))))...)))))}((((({{{((((((.{........}.))))))))))))))))))))).}},)))).)}}))).}}}.,)))))))).,.{{{{,....,})))}..,....{{{|{.,{|,.,{{{{.(((,{,({((({,,({((((.(((((........(((((........)))))))))))),)))),........,,((({......)))}..|||||{,......}}}})|||||.,,}}},.}}||,{(((.(((..(((((((...)))))))..))).,,)}}),,...,,))))},),)))))}||,|}.||||},},,}}|..,,}},)}.((((...))))....(((((.(((....))).))))).}}}))}},)))))))..))))))))))))))))))..,,.)))))))))...{{{((((,((({{.,.....,})}))})}}},.,}........,((.(((((((....{{.,(((((((((((.......)))))....))))))..)}......)))))))))}(((((((((({(((...((((......((((({(((,,((((((((((({...(((((...,((({,...|,||{{...........}}}}.,,|},|(({...((((((((,,,,{,..,(((({{{..({{{{.,..,......,........},...})))).))))))}.,..............})))))))..}))}........)))))..}))))).)))))))))).}))))).))))....)))}...))))))))))...,,)})))),,,,,.....{((((((....)))))))(((((((((.(({....}))...)))))))))...,,,.........{{{({.{{,,.....))})))))......((((((((((....(((((((..((((({,{,.,.,{{{,..||..,,.},,,}}}}}{{(({({{.{{..,.......}),}}))},}}}|(((((.....,}))),))))))..))))))).....))))))))))......|||||.|||...({...(((((.....))))).)))}}.})),,})))))}))).)})))..,||,,.,})))..,..))))).....)))))))}.))))))}........{{{....}}}.....))).))))).....(((((.....))))).))).

Transcripts

ID Sequence Length GC content
AGAAAGCCCACGUUGGCCGCUGCGGGGAGCGCGGCGUGGAGAGGCGGGA… 3784 nt 0.5566
Summary

This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates a wide range of biological processes including iron homeostasis, fat and bone development, and ovulation. Differential expression of this gene may be associated with progression of breast and prostate cancer. Mutations in this gene may be associated with iron overload in human patients. [provided by RefSeq, Jul 2016]

Forensic Context

A study in rats demonstrated that local mRNA expression of the BMP6 was significantly downregulated at the fracture site in a polytrauma model compared to an osteotomy-only group at 10 days post-trauma, correlating with a significant reduction in bone volume fraction and impaired healing [Mangum et al. DOI:10.1186/s13018-019-1082-4]. In human cardiac tissue, single-nucleus RNA sequencing revealed that the BMP6 gene was upregulated in fibroblasts and correlated with fibrosis in ischemic cardiomyopathy [Simonson et al. DOI:10.1016/j.celrep.2023.112086].