| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAAGGCGGCGGCGGAGGAGGCCCAGAGACCGGAGCGCGGAGACCUCAG… | 4242 nt | 0.4439 |
This gene encodes an ubiquitin-like protein (ubiquilin) that shares high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain a N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases; and thus, are thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This ubiquilin has also been shown to bind the ATPase domain of the Hsp70-like Stch protein. [provided by RefSeq, Oct 2009]
A study in human postmortem brain tissue demonstrated that the UBQLN2 is down-regulated in both the frontal and motor cortices of alcoholic cases compared to controls, as part of widespread changes in the ubiquitin-proteasome system gene expression profile [Liu et al. DOI:10.1111/J.1471-4159.2004.02570.X].