Basic Information

Symbol
UCHL1
RNA class
mRNA
Alias
Ubiquitin C-Terminal Hydrolase L1 PGP9.5 Uch-L1 UCHL-1 Ubiquitin Carboxyl-Terminal Esterase L1 (Ubiquitin Thiolesterase) Ubiquitin Carboxyl-Terminal Hydrolase Isozyme L1 Neuron Cytoplasmic Protein 9.5 Ubiquitin Thioesterase L1 Ubiquitin Thiolesterase PGP 9.5 PARK5 Epididymis Secretory Protein Li 53 Epididymis Luminal Protein 117 EC 3.4.19.12 HEL-S-53 HEL-117 SPG79A UCH-L1 NDGOA PGP95 SPG79
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_004181.5
Sequence length
1103.0 nt
GC content
0.5005

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-354.30 kcal/mol
Thermodynamic ensemble
Free energy: -376.21 kcal/mol
Frequency: 0.0000
Diversity: 328.88
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((...((((.(((.......)))))).)....))))))).))))))...((((.(((......(((((.(...((((.(((......)))..))))).)))))......))).))))(((((((((((((((((((.(((..((.((((......(((.((((((((((....).))).))))))..))).....)))).))..))))))))))))((..((((((...........))))))..))...(((((.........))))).........))))))))))(((....((((((((.(((((((.......(((((((....((((.((((((....(((((((.((((((....(((((((..(((.((((((((((.(((((((.......))))))).)))..........(((((((...)))))))........(((((......((((((((.((.(((((((((((.(((((((...((((((((..(((...(((((....(((((..................)))))....))))).)))..)))))))).......))))..))).)))..)))))))).)).((((((((....))).)))))))..))))))...((((((((((....(((.((((((..((...((((((....))))))((((...((.....))..))))))...)))))).)))((((((..............))))))....((((...)))).................(((........)))..((((...((((...))))))))........))))))))))..)))))...(((((((((((((((((((((..((....)).))))))...........)))))....)))))).)))).)))))).).)))..)))))))))))))...)))))))...............(((......)))....)))))).))))..))))))).(((((........))))).......((((.(((..(((((.......)))))..)))...)))))))))))..))))))))...)))...
Thermodynamic Ensemble Prediction
(((((((((((((...((({.(((.......)))))).}....))))))).))))))...((((.(((.,..{.(((((.{,..((((.(({......)))..))))}.))))).,....)}},||))((((((((({(((((((((((((..((.((((.,....(((.((((((((((,,..,,,}).))))))..))),..}.}))).))..)))))))))))),,..((((((...........}))}}).,)}...(((((.,....,,.)))))..,,.....)))))))))){{{,,,,{(((((((.(((((((.....{{(((,,{..{.,(,(({(((((,....(((((((.((((((....(((((((..(((.(((((({{({.{((({,{,{|...))))))},.}}}...,,.....(((((((...}))))))........{,{(({{,...((((,{....,.|||||||||,|.(((((((...((((({((,.{{{,,,(((((....({(({,,,,,,,.{{,,,..,,,|||||.{..}})}},}}),.}}}})))))}.,...)))}..}}},))|.,||,|||||{,..((((((((....))).))))),,..))})))}.}||{(((((({|..|(({,({((({{,((..(((((((....)))))))|||,,,||}},,,))}.||||},...,))))},}}|(((((({.......,,..,.}},,,.,,,,{{{,...,)}}................,(((,.......))}..((({...((((...)))))))).....,,,}})))))))),.)))))}}.(((((((((((((((((((((..((....)).)))))).,....}}...)))))....)))))).)))).)))))).}.)))..)))))))))))))...))))))).....,.........|,,.....})))}}}}.))),,.,,))})),,||||.(((((........))))),}}},{{(((({(,,..||||,,,,,.|,|,||,...)).,}),,.)))))))..))))))))...,}}...

Transcripts

ID Sequence Length GC content
AGCUGUUUUUCGUCUUCCCUAGGCUAUUUCUGCCGGGCGCUCCGCGAAG… 1103 nt 0.5005
Summary

The protein encoded by this gene belongs to the peptidase C12 family. This enzyme is a thiol protease that hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. This gene is specifically expressed in the neurons and in cells of the diffuse neuroendocrine system. Mutations in this gene may be associated with Parkinson disease.[provided by RefSeq, Sep 2009]

Forensic Context

A study in humans demonstrated that UCHL1 was upregulated in the subcutaneous adipose tissue of heavier monozygotic co-twins discordant for body mass index, associating with clinical traits of unhealthy obesity [Muniandy et al. DOI:10.1038/ijo.2017.95]. In pigs, research showed that UCHL1 was a commonly regulated gene marker in the skeletal muscle of both Tibetan and Bama breeds upon cold exposure [Yang et al. DOI:10.3390/ijms24087431]. A systematic review of post-mortem traumatic brain injury (TBI) biomarkers in humans identified the UCHL1 as a clinically relevant protein for cause of death determination, noting it should be investigated in post-mortem body fluids for future forensic application [Zwirner et al. DOI:10.1007/S00414-022-02785-2].