Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUGUUUUUCGUCUUCCCUAGGCUAUUUCUGCCGGGCGCUCCGCGAAG… | 1103 nt | 0.5005 |
Summary
The protein encoded by this gene belongs to the peptidase C12 family. This enzyme is a thiol protease that hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. This gene is specifically expressed in the neurons and in cells of the diffuse neuroendocrine system. Mutations in this gene may be associated with Parkinson disease.[provided by RefSeq, Sep 2009]
Forensic Context
A study in humans demonstrated that UCHL1 was upregulated in the subcutaneous adipose tissue of heavier monozygotic co-twins discordant for body mass index, associating with clinical traits of unhealthy obesity [Muniandy et al. DOI:10.1038/ijo.2017.95]. In pigs, research showed that UCHL1 was a commonly regulated gene marker in the skeletal muscle of both Tibetan and Bama breeds upon cold exposure [Yang et al. DOI:10.3390/ijms24087431]. A systematic review of post-mortem traumatic brain injury (TBI) biomarkers in humans identified the UCHL1 as a clinically relevant protein for cause of death determination, noting it should be investigated in post-mortem body fluids for future forensic application [Zwirner et al. DOI:10.1007/S00414-022-02785-2].