| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGGGUCCUGCUGGCGCGAGGGUGGGUAGGAGGGGACGCGGGGACUCG… | 1621 nt | 0.4633 |
Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the UCP1 mRNA expression was significantly up-regulated in brown adipose tissue after burn injury, with a 17.88-fold increase at 24 hours post-burn, and was also detectable and up-regulated in white adipose tissue, indicating its role in mediating hypermetabolism and increased energy expenditure [Zhang et al. DOI:10.1097/BCR.0b013e318166739c]. In a separate investigation in pigs, the UCP1 was mentioned as lacking functional expression in modern domestic breeds, which contributes to their cold sensitivity [Yang et al. DOI:10.3390/ijms24087431]. A study in mice demonstrated that acute cold exposure (4°C for 4 hours) significantly elevated the RNA level of the UCP1 in subcutaneous white adipose tissue, a key marker for beige adipocyte formation, with its upregulation being part of the enriched PPAR signaling pathway [Liang et al. DOI:10.3390/ijms20163968].