Basic Information

Symbol
UCP3
RNA class
mRNA
Alias
Uncoupling Protein 3 SLC25A9 Uncoupling Protein 3 (Mitochondrial, Proton Carrier) Putative Mitochondrial Transporter UCP3 Solute Carrier Family 25 Member 9 Mitochondrial Uncoupling Protein 3 Uncoupling Protein-3 UCP 3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003356.4
Sequence length
2277.0 nt
GC content
0.5397

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-790.10 kcal/mol
Thermodynamic ensemble
Free energy: -831.49 kcal/mol
Frequency: 0.0000
Diversity: 519.49
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((((((......((.(((((........))))).)).....(((((((((((..(...((((((.((((.((.((((....((((((((((((....(((((((((.(((((((.((.(((..((((((((((.(.(((((((((((((((.((....(((((((....))).))))((((.((......(((((.((((((..(((((...)))))..(((((((((.(((.((((....))))..)))))).))))))..((((.......)))).........((........))...)))))).))))))))))))).))))))))))))....)))).)))..)))))))))))))))))))...)))).).)))).......))))).))))))))))))).).))))))))).(((((.......)))))(((.((((.(((.((((((..(((((((....((((..((((((..(((((((..((((((.((.....(((....))).....((((..(((....))).)))).......((((((((.((((((((...((((((.(((.....)))..))))))..))))).........))).))))))))......((((.............)))).(((..(.((((...........(((..........)))...........)))))..))).)).)))))))))))))))))))..((........))........))))...))..)))))....))))))))))))).)))..)..))))))..)))))..((.(.(((....))).).))))))))...(((((((((((.(((((((((((((((((((.(((((..(((..(((((.((....(((.....)))..)))))))..))).))))).......((((((((.((((..(((((((((((((((....((((.((......(((.(((((....))))))))......))))))))))........((((((((((..((.(((((((..((..(((.....((((((((...))))))))......)))..))..)))....(((((..(((..(((((..(((((((((......((((....(((........)))....)))).....(((........)))...)))))))))..))).)).)))..))))).....)))).))...........(((.((((((.((((.........)))))))))).))).)))))))))).(((((.(..(((((((..(((((((((((((((....((((((((.((((....)).)).)))))))).........))))))).........)))))((((((...)))))).......................(((((((.....))))))).))))))))))..).)))))........(((.(((............))).)))...(((((((..((.((((.(..((....(((((......)))))...)).))).))..)).(((.(((.((((.((((((..((((..(((((.((.((((..((........))..)))))).)))))............(.((((...)))).)((.(((((((.(((...))).))))))).))...........((..(((....)))..))..((((....))))...))))..)))))).(((.......(((..((....))..))).......))))))).))))))((((((........)))))).)))))))((((((((..((((((....))))))......(((((.(((.....)))..)))))................((((...((((.(((((((((..((.(((((......)))))))..)))))).......))).))))...))))))))))))..)).))).))).)))....)))).)))))))).)))))))...))))))).((((((..((((((....((((.....(((..(((....).))..)))..))))...))))))))))))(((((((((.((.(((((((....)))))))..........)).))))...))))).....(((......)))(((......)))))))).))))).....(((((((.(((..((....))..)))......)))))))(((((...)))))))))))...........
Thermodynamic Ensemble Prediction
........{{(({...,.,.((.(((((........))))).))|.,..(((((((((((..(...((((((.(({(.((.((((....((((((((((((.,,.(((((((((.(((((((.(,{(((..((((((((((.(.(((((((((((((((.((,..{(((((((....))).))))|{{|.|(......(((((.((((((|.(((({...}))))..(((((((((.(((.((((....))}}}.)))))).)))))),{(((,......,)))|.,...,,..{{........)),..)))))).))))))))}))}).)))))))))))}...,)))).))),.,))))))))))))))))))...)))).).)))),,.....))))).))))))))))))).}.))})))))),(((((.......)))))|((.((({{(((.((((((..(((((((....((((..((((((..((((((,.,((((((.{,..,.((((({.({,{(({..((((..(((....))).)))){.{{.((.(((,..((((((((((...((((((.(((.....)))..))))))..)))))....((.((((((..((((.,....,.))))..))).))).)).)))))))).))}).}............},)))....)).}))))).,....((.{{.....}).}),.)))))))))))))))))))..((........))........))))...))..}))))....))))))))))))).))}..)..)))))},.}))))..{{.(,(({.,,.|},{|{|||}|||}...,((({((({{({(((((((((((((((((((.(((((,.(((.,(((((.{{,,{,(({.,,,,)})..}})}))},.))).))))).......((((((((.((((,.(((((((((((((((,...((({.{{......(((.(((((....))))))))...,,,|}}}|}}}||,,,,,,.((((((((((((.(((((..(((((((..(((.....((((((((...)))))))).}....)))..)){{{......,.((((((.(((((((.{{(((((((((.(((.......{.{(((...((((((.....((((((,...(((........)))........,((((......))))...,)))))),{,,........||||.....{({.{(((((.((((.........))))))))),.))).(((((..((((....))))..))))).)))))).))))}.,{{{,,..,,|||||{,(,((,...,|,||{|||||||{,,....,,}}}}}}.....}},}}}))},(((((({...}))))))......................(((((((.....)))))))..))).))))))}).}).))))))).)))))),,,................}},..)))))..))))).))))).))))))).(((((......))))).....,{,,{{{{.{{{(((.{((...}}.})),|{,,,{,((,(((((.((.((((..((........))..)))))).)))))}}.,}}}}....{.((((...)))).}{({(((((((.(((...))).))))))),,}...........}},|{||||,,|||..,...((((....)))),,.},),.))),})))))},,,....{((((((.{({{..{{{....})}.{,,(({.,{{|{{,,{{({{...,,,.}})||||,}},.))}|||{,((((((,((({...,))|||{{.....(((((.(((.....)))..)))))...}}}}},,.....{((....))},|,|||{{((((..{{.(((((......)))))})..)))))).,..,)))))).)))).)))),)))))))...))}}})},}).))).,..)))).)))))))).)))))))...))))))).((((((..((((((..{,((((.....(((..{{|.,.,}.))..)))..))))}..))))))))))))(((((((((.({.(((((((....))))))).,....,}..,).))))...)))))....}|||}}}...}},|||.,,,..,,,,,))),))))).(((((.....}))))......,{{{......}}},......|((((((...))))))))})).....,,,,..

Transcripts

ID Sequence Length GC content
AGAGACAACAGUGAAUGACAAGGAGGGGCCAUCCAAUCCCUGCUGCCAC… 2277 nt 0.5397
AGAGACAACAGUGAAUGACAAGGAGGGGCCAUCCAAUCCCUGCUGCCAC… 2107 nt 0.5301
Summary

Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]

Forensic Context

A study in pigs demonstrated that the UCP3 protein expression was significantly upregulated in the biceps femoris and longissimus dorsi muscle of cold-exposed Tibetan pigs, indicating its participation in skeletal muscle thermogenesis [Yang et al. DOI:10.3390/ijms24087431]. In human pediatric burn patients, microarray analysis of skeletal muscle revealed that the UCP3 gene was not differentially expressed following burn injury [Aria Tzika et al. DOI:10.3892/ijmm_00000244].