| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCGCGCAGCGGGAAGAGCCGGCCGAAGCGUGGCGGCCACAGACUGUG… | 4850 nt | 0.3771 |
UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
A study in mice demonstrated that exertional heat stroke induces a sustained epigenetic memory in the left ventricular myocardium lasting at least 30 days, characterized by widespread differential DNA methylation, including a hypomethylated promoter region of the UGGT2 gene with a 22% mean decrease across 8 CpGs [Murray et al. DOI:10.1152/physiolgenomics.00147.2021].