Basic Information

Symbol
UGT2B17
RNA class
mRNA
Alias
UDP Glucuronosyltransferase Family 2 Member B17 C19-Steroid-Specific UDP-Glucuronosyltransferase UDP-Glucuronosyltransferase 2B17 C19-Steroid-Specific UDPGT EC 2.4.1.17 UDP Glucuronosyltransferase 2 Family, Polypeptide B17 UDP Glycosyltransferase 2 Family, Polypeptide B17 UDP Glycosyltransferase 2 Family, Member B17 UDP-Glucuronyltransferase, Family 2, Beta-17 UDPGT 2B17 UDPGT2B17 EC 2.4.1 BMND12
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001077.4
Sequence length
2481.0 nt
GC content
0.4071

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-669.20 kcal/mol
Thermodynamic ensemble
Free energy: -719.67 kcal/mol
Frequency: 0.0000
Diversity: 499.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.......(((((....))))).......((((((((......(((((.(((((...(((.(((.(..(.((((((.((.((((((((((...((((........((((((((((...)))......((((..((((((((((((.((((.(((.....))).)))).)))))((((...((((.(((((...))))).)))))))).(((((.(((....((((....(((((((...((((((....)))))).))))......)))....))))..)))....)))))..((.....)).......(((((((((......(((.....((((((((((....((((....(((.(.(((((...))))).).))).....)))).......((((((((....((..((((.(((.(((((...((((((.(......))))))).)))))..))).).)))..)))))))))).((.((((((...)))))).))..))))))))))....)))........)))))))))..............((((((.((((((((((((((((.(((.((((..((((((((((.(((..((((.((.((((((((((.(((((((.((((((((.((((((........(((.((.......)).)))...........((((((.(.((.(((((((((((..((((((.......))))))...((((((....))))))(((.((((((.((.((((.((((.((((...)))))))))))).))..)))))).))).....(((((....))).)).(((((......)))))))))))))))))).)..))))))....(((((((((..((((.((((((((((..(((((((((((((((.((((...(((((((..............(((((((((((((((((((..(((......)))..)))).....))))))(((.......))).(((((.(((((.....((((((..((((........))))..))))))...))))).)))))..........(((.(((((((((......((((...))))..))))))))))))...((...(((((((.(.((((((((((((((((((.((((..((..(((((...(((((..(((((((.((((.......)))).((((((((((...)))..)))))))....)).))))))))))...))))))).)))).)))))..))))))))))))).).(((((((.(((.((.........))))).))))).))...(((((((((((((((.((...)).)))))))))))))))...((((..(((((((((((........))...))))).))))))))((.(((((((((((((((............))).))))))..))))))..))...........)))))))...)).))))))))))))))))...)))).((((((.....))))))...........))))).....)).))))).)))...))))))))))............((((((((...))))))))((((.((((((((...((...(((...(((.........)))..)))..))))))))))..))))))))...)))))))))(((...))).))))))))))))))....))))))).((((........))))............)))))))....))).))...))))..))).))))))).))).))))..)))))))).)))))..))))))))))))..)))))))..)))).....)))))))))))....))))))))))..)).)))))).)..).))).)))..(((((....)).)))......((((((.((((..((..((((((..((((.......))))......))))))..(((((....)))))))..))))...))))))...)))))..)))))...((((((((.(((..((((..((((((.(((((.((((.((((.(((((((((((((((...))))).....)))).)))))).)))).))))..)).........))).)))))).(((((......)))))..............))))..))).))))).)))))))))))..........(((...((((((((.......(((.(((((((((((((..((....))..))))))))....))))).)))......))))))))....))).........))))))))......((((((......(((((((....(((((((......(((........)))........))))))))))))))..........(((((...(((..(((((((...)))))))..)))...))))))))))).........................
Thermodynamic Ensemble Prediction
((((((((,,{{,..(((({....})))).,,({{,((((((((,...,.(((((.(((((.,.,{{.{,,,|..|.((((({.{(.((((((((((...((({.......,((((((((((...)))......((((..((((((,(((((.{(((.(((.....))).)))}.))))){||{...((((.(((((...))))).))))||||.(((((.(((.{,.((((....(((.{,({({((((((....)))))),)}.)),....)))....))))..))).,,,)}}))}|({.....)).,,....(((((((((......(((..{..((((((((((....((((..{,(((.(.(((({...})))).).)))..,,.)))).......((((((((,...{(..((((.(((.(((((...((((((,{......))))))).)))))..))).).)))..)))))))))).((.((((((...)))))).))..)))))))))).}..)))...,....)))))))))..,.,....,,,..((((((.((((((((((((((((.(((.((((..((((((((((.(((..((((.{,.{{{(((((({.(((((((.((((((((.((((((........,{{,({,,.....,,.|||,,.........{{{{{{,|.{{.(((((((((({..(((((({.....}))))))...((((((....)))))){({.((((((.{,.{(((.((((.((({...})))))))}))).,,..)))))).})}.....(((((....))).)){(((((......)))))))))))))))))).}..)))))}....(((((((((..((({.((((((((((..(((((((((((((((.((((...((((((({.............,(((((((({(((((((((,.(((,,....})),,))}))),..)))))}(((.......))).(((((.(((((.....((((((..((((........))))..))))))...))))).)))))..........(((.(((((((((......((({...)))}..)))))))))))).,,,{...(((((((.{.((((((((((((((((,,.{{((..,,..(((((...(((((..(((((((.((((,.....,)))).(((((({((,...))}..}))))))....)).))))))))))...))))),}.,}}).)),,)))))))))))))))).,.(((((((.(((.((.........))))).))))).)).,,{((((((((((((((.({...}).))))))))))))))),,.((({{{((,,((((({,........}}...))))),)))))))}{{.(((((((((((((((.,..........))).))))))..))))))..}}...........)))))))...})}))))))))))))))))...)))).((((((.....))))))...........))))).....)).))))).)))...))))))))))..,{,,...,|,((((((((...))))))))((((.(((((((({{,{{,,,,({...{{,...,.,}}.}}...}},,,)}))))))))..)))),))).,.)))))))))(((...))).))))))))))))))....))))))).((((........))))............)))))))....))}....,,))))..))).)))))))},)).)))}..)))))))).)))))..))))))))))))..)))))))..)))).....)))))))))))....))))))))))..)).))))))....|.|||{||,..{,,,,.,}}))}|}}...,|,|{{{{{.|{((..{{..((((((..{(((.......}}}}......)))))),,(((((....}}},,)}..)}))...))))},.,.)))))..})))).,,{({(((((.(((..((((,.((((({.(((,,.{(((.((((.(((((((((({(((,...,)))),,...)))).)))))).)))),))))..,,.,,......))).}})}}}.{({{{....,.}}}))........,,,,..))))..))}.))))).}})))))))))}}|,}},...,,,...{(((((({....,,.(((.(((((((((((((..((....))..))))))))....))))).))),,....})))))))....}},..,,}},..)))))))).....,{{.....,,...(((((((....(((((((......{{{........})}........))))))))))))))..,{{.....{((((...{{{..(((((((...}))))))..)))...))))),}}},}.,,,............,,.......

Transcripts

ID Sequence Length GC content
GAGCUCAGAUUUUAAGGCAGUAUCUUGCCAAUGUUCCCAGCUGAAUAAA… 2481 nt 0.4071
Summary

This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Copy number variation in this gene is associated with susceptibility to osteoporosis.[provided by RefSeq, Apr 2010]

Forensic Context

A study in humans demonstrated that the UGT2B17 mRNA transcript exhibited a 22-fold higher expression in CEU (European) populations compared to Asian populations in lymphoblastoid cell line studies, enabling differentiation of Caucasian and Chinese cohorts with high specificity and sensitivity in B cell lines and peripheral blood [Daca-Roszak, P.; Zietkiewicz, E. DOI:10.1007/s13353-019-00510-1]. This review presents the potential of such population-specific transcriptomic markers for forensic applications, including ascertaining population affiliation of human samples.