| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGCUCAGAUUUUAAGGCAGUAUCUUGCCAAUGUUCCCAGCUGAAUAAA… | 2481 nt | 0.4071 |
This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Copy number variation in this gene is associated with susceptibility to osteoporosis.[provided by RefSeq, Apr 2010]
A study in humans demonstrated that the UGT2B17 mRNA transcript exhibited a 22-fold higher expression in CEU (European) populations compared to Asian populations in lymphoblastoid cell line studies, enabling differentiation of Caucasian and Chinese cohorts with high specificity and sensitivity in B cell lines and peripheral blood [Daca-Roszak, P.; Zietkiewicz, E. DOI:10.1007/s13353-019-00510-1]. This review presents the potential of such population-specific transcriptomic markers for forensic applications, including ascertaining population affiliation of human samples.