Basic Information

Symbol
ULBP2
RNA class
mRNA
Alias
UL16 Binding Protein 2 RAET1H Retinoic Acid Early Transcript 1H UL16-Binding Protein 2 NKG2D Ligand 2 ALCAN-Alpha NKG2DL2 N2DL2 Retinoic Acid Early Transcript 1L RAET1L N2DL-2
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_025217.4
Sequence length
1335.0 nt
GC content
0.4697

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-383.70 kcal/mol
Thermodynamic ensemble
Free energy: -409.17 kcal/mol
Frequency: 0.0000
Diversity: 358.95
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((((((.......(((..(((.(((..(((((((.(..(((((..(((..((((.((....)).))))..)))..))..(((.((((.((((....((....)).(((.((((.((((......)))).)))))))...................((((((((((..(((..............)))..))))))))))))))....)))))))(((((.(((((...))))))))))..(((((((.........))))))).......)))..).)))))))))).)))..))).......)))))))))(((.((((((..(((((((((((((.(((((((.........(((...((((((((...(((((((((............)).(((....)))....((((..(((((.....)))))..))))..)))))))...))).)))))...)))((((((....(..(((..((((((......(((.((((((...)))))).)))...((((((....))))))(((((((((((...((((((.....((.(((((.((((...((((((((((.....((((((((.......)))))))).(((....((.((((((((((((.........(((.(((...((..((((.(......).)))).)).)))...)))..)))))))))).)).)).....)))))))))))))........((.....))...........)))).)))))))..))))))....))))).))).))).(((.(((((.(.(((.(((.......))).)))).))))))))..((((((..(((((((((.....(((....(((((..(((((.(((..((..(((...)))...))..))))))))....)))))...)))....)))).))))).....))))))...)))))))))..)...)))))).....))))))).).((((....))))..............)))))))))))).((....))................)))))))))..((((((((((......................))))))))))....(((((......)))))..))))).((((((.((...........((((((((.......((((..(((((((((....))))))..)))...)))).........(((((...(((((((((.((...((((.((((.........)))).)))).)).)))))))))..))))).))))))))....)).))))))................
Thermodynamic Ensemble Prediction
..,,,,,(((((((((.......(((..(((.(((..(((((((.(..{{((({.,,,..((((.{{.,,,||.||||,,}||{{{{.{(((.((({.({((..,.((....||.({{(((((.(,{{|.,,,,)))).)))})},.........,...,...,{((((((((((..{{{....|,.,,,....)))..)))))))))})))),,..}})))}|(((({.(((({...,)))))))}},.{((((((.........))))))}.,,},,,))),.}.)))))))})).)))..))).......)))))))))(((.((((((..(((((((((((((,(((((({.........{((...((((((((.,.(((((((((.,..........}}.(((....)))....((((..(((((,...,)))))..))))..))))))).}.))).))))),,.))}{(((((....{..(((,.{(((((......(((.((((((...)))))).)))...{(((((....)))))|{((((((((((..,((((((,{...((.(((((.((((...((((((((((..,,.((((((((.......)))))))).|{(....((.((((((((((((......{{{(({.(((...((..((((.(......).)))).)).)))..,}))}})))))))))).)).}).....}})))))))))))........||.....,}.,}....,,..)))).))))))).})))))).,..))))).))).)))}(((.(((((.(.(((.(((.......))).)))).))))))))..((((((..(((((((((,....(((....(((((..(((({,(((..{(.,(((...})}}}.})..))))))))....)))))...}))},..}))).))))).....))))))...)))))))))..}...)))))}.....}}))))}{|{({{(....,}}}......,},....,)))))))))))).,{.,..||....,}..,.......)))))))))..,,,,,,((((..........,.,.......{{||||||||||{..{(({{({{{...|||||{{||{{{{{{{((({{,{{,,..,,..,|}||||,|,....,,||||,.|||((((((....))))))..,||,||}},}....)))))|{{{{...(((((((({,{{...((({.{{{(,,{....},))}}.}))).,},)))))))))..))))}}))))))).)))}))}))))))................

Transcripts

ID Sequence Length GC content
AUUCAUCUUCCAGGCUCUCCUUCCAUCAAGUCUCUCAUCCCUAGCGCUC… 1335 nt 0.4697
Summary

This gene encodes a major histocompatibility complex (MHC) class I-related molecule that binds to the NKG2D receptor on natural killer (NK) cells to trigger release of multiple cytokines and chemokines that in turn contribute to the recruitment and activation of NK cells. The encoded protein undergoes further processing to generate the mature protein that is either anchored to membrane via a glycosylphosphatidylinositol moiety, or secreted. Many malignant cells secrete the encoded protein to evade immunosurveillance by NK cells. This gene is located in a cluster of multiple MHC class I-related genes on chromosome 6. [provided by RefSeq, Jul 2015]

Forensic Context

A study in human skin demonstrated that the ULBP2 was significantly up-regulated in thermally injured tissue compared to normal skin during the early wound repair process, as part of a broad inflammatory and immune response involving 2,286 altered genes [Greco et al. DOI:10.1016/j.burns.2009.06.211].