| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCAUCUUCCAGGCUCUCCUUCCAUCAAGUCUCUCAUCCCUAGCGCUC… | 1335 nt | 0.4697 |
This gene encodes a major histocompatibility complex (MHC) class I-related molecule that binds to the NKG2D receptor on natural killer (NK) cells to trigger release of multiple cytokines and chemokines that in turn contribute to the recruitment and activation of NK cells. The encoded protein undergoes further processing to generate the mature protein that is either anchored to membrane via a glycosylphosphatidylinositol moiety, or secreted. Many malignant cells secrete the encoded protein to evade immunosurveillance by NK cells. This gene is located in a cluster of multiple MHC class I-related genes on chromosome 6. [provided by RefSeq, Jul 2015]
A study in human skin demonstrated that the ULBP2 was significantly up-regulated in thermally injured tissue compared to normal skin during the early wound repair process, as part of a broad inflammatory and immune response involving 2,286 altered genes [Greco et al. DOI:10.1016/j.burns.2009.06.211].