| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGCGGCUGCGCGGGCGUCUCAGGCUCUGAGGCCCGGGCGCCGCGGCU… | 5322 nt | 0.6422 |
Enables identical protein binding activity; protein serine/threonine kinase activity; and small GTPase binding activity. Involved in several processes, including autophagosome assembly; protein phosphorylation; and regulation of autophagy. Located in bounding membrane of organelle; cytosol; and phagophore assembly site membrane. Part of Atg1 /ULK1 kinase complex. Is active in cytoplasm. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulates the ULK1 in cortical microglia, where it is involved in autophagy and mitophagy pathways [Oladapo et al. DOI:10.3390/Ijms26020649].