Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGCACCUCCUCCCACUGCGGGCAAAGGGCAGGCAGUUCGUGCGCGGAC… | 3823 nt | 0.4986 |
Summary
This gene encodes a protein that belongs to the CN hydrolase family. Beta-ureidopropionase catalyzes the last step in the pyrimidine degradation pathway. The pyrimidine bases uracil and thymine are degraded via the consecutive action of dihydropyrimidine dehydrogenase (DHPDH), dihydropyrimidinase (DHP) and beta-ureidopropionase (UP) to beta-alanine and beta-aminoisobutyric acid, respectively. UP deficiencies are associated with N-carbamyl-beta-amino aciduria and may lead to abnormalities in neurological activity. [provided by RefSeq, Jul 2008]
Forensic Context
A study in humans established a targeted RNA sequencing protocol for predicting the time-of-day of bloodstain deposition, where the UPB1 was identified as a top-ranking mRNA marker with a large negative coefficient in the final penalised regression model's cosine component, having shown its highest expression at 8 AM in prior whole transcriptome sequencing [Gosch et al. DOI:10.1101/2025.02.03.636230][Gosch et al. DOI:10.1016/J.Fsigen.2025.103287]. The final model, incorporating this and other diurnally rhythmic markers, achieved a root mean squared error of 3 hours and 44 minutes, with 78% of predictions correct within ±4 hours via five-fold cross-validation.